175,655 results
-
Plasmid#26646PurposeMammalian coexpression of nls-Cre and EGFP from the CAG promoterDepositorInsertCre
UseCre/LoxTagsGFP and IRES2ExpressionMammalianPromoterCAGAvailable SinceDec. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
Lambda Phosphatase
Plasmid#79748PurposeIntended for co-expression with human Ser/Thr kinase plasmids to enhance bacterial kinase expression.DepositorInsertLambda Phosphatase
ExpressionBacterialPromoterT7Available SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
PS6K-mcherry-iATPsnFR1.1
Plasmid#227238PurposeInducible ATP sensor for E. coliDepositorInsertiATPsnFR1.1
TagsmCherryExpressionBacterialAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Immunostealth
Plasmid#239446PurposeExpresses murine NIS (mNIS) in mammalian cells for non-immunogenic in vivo imaging using SPECT or PETDepositorAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV2)
Viral Prep#37825-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceOct. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKV057
Plasmid#133312PurposeBeYDV viral replicon on T-DNA backbone expressing Firefly Luc+, WUS2 and IPTDepositorInsertLuc+. WUS2, IPT
ExpressionPlantPromoterAtUbi10, Nos, 35SAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TFEB-WT-MYC (#647)
Plasmid#99955Purposemammalian expressionDepositorAvailable SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28 His6-mEGFP-D4
Plasmid#226372PurposeProduction of recombinant mEGFP-D4, a fluorescent probe binding cholesterolDepositorInsertD4 (pfoA Clostridium perfringens)
TagsHis6 and monomeric EGFPExpressionBacterialPromoterT7Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSDest-HA-TMPRSS2
Plasmid#154963PurposeTMPRSS2 with N-terminal HADepositorAvailable SinceJuly 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
CRY2olig-mCherry
Plasmid#60032PurposeExpresses a fusion of CRY2PHR E490G with mCherryDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHCMV_DENV2_PrME
Plasmid#207264PurposeMammalian expression of Dengue virus 2 PrME proteinDepositorInsertDENV2_PrME (POLY Dengue virus 2)
ExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GalT-mCherry
Plasmid#214271PurposeMammalian expression of GalT-mCherry (Golgi marker)DepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
R701-X65-527: His6-tev-Hs.CALM1(2-148)
Plasmid#159693PurposeE. coli protein expression of His6-tev-Hs.CALM1(2-148)DepositorAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO ChETA-EYFP (AAV5)
Viral Prep#26968-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-DIO ChETA-EYFP (#26968). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO ChETA-EYFP plasmid DNA. EF1a-driven, Cre-dependent, ChETA fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-EcoEnv
Plasmid#15802DepositorInsertMLV env (ecotropic)
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-EKAR4
Plasmid#205513PurposeGenetically encoded FRET-based biosensor for monitoring ERK kinase activity. Targeted to endosomes.DepositorInsertendo-EKAR4
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and 6xHI…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-palm-mScar3-10xSunTag
Plasmid#240626PurposeExpresses a fusion construct containing a palmitoylation motif, mScarlet3 and 10 repeats of the SunTag (GCN4) peptide, to luminally tag extracellular vesicles for use in EV-FUSIM assay.DepositorInsertpalm-mScarlet3-10xSunTag
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceMarch 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
Bison sgRNA library
Pooled Library#169942PurposeKnockout library targeting ubiquitin ligases, deubiquitinases, and control genes.DepositorUseLentiviralAvailable SinceSept. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
epi-BE4max
Plasmid#135975PurposeExpresses AncBE4max, EBNA1 and blasticidin resistence gene; cloning backbone for sgRNA; Contains Epstein-Barr virus oriP replication originDepositorTypeEmpty backboneExpressionMammalianAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-R-Creon shRNA[Control]
Plasmid#180775PurposeThis vector simultaneously expresses mCherry protein and shRNA in a Cre-dependent manner.DepositorTypeEmpty backboneUseAAV, Cre/Lox, and RNAiExpressionMammalianAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2/CMV-Luc/PGK-SB100X
Plasmid#192869PurposeCarries luciferase under CMV promoter flanked with IR/DR elements. Also carries SB100X under PGK promoter outside of the IR/DR elements.DepositorInsertsluc
SB100X
ExpressionMammalianAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSK
Plasmid#136552PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, Klf4DepositorUseLentiviralExpressionBacterialPromotertetO-miniCMV (dox-inducible)Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1α-Dest
Plasmid#133299PurposeThe pT3-EF1α destination vector without any insert which can be used for LR reaction.DepositorTypeEmpty backboneExpressionMammalianPromoterEF1αAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE
Plasmid#130995PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of human synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1PromoterhSynAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpliceExpress
Plasmid#32485DepositorTypeEmpty backboneAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRC-CMV-Rev1b
Plasmid#204153PurposeLentivirus helper plasmid coding for RevDepositorInsertRev
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_EGFPligand
Plasmid#79129PurposeLentiviral vector for surface expressed EGFP (SFFV promoter)DepositorInsertEGFP surface ligand
UseLentiviralAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-NpHR3.3-EYFP (AAV8)
Viral Prep#137152-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Fon-NpHR3.3-EYFP (#137152). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon-NpHR3.3-EYFP plasmid DNA. nEF-driven, Cre and Flp-dependent expression of NpHR3.3-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre and Flp-dependent)Available SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
MIC60-mCherry
Plasmid#232789PurposeEncodes an mCherry-tagged MIC60/IMMTDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-mCherry
Plasmid#114470PurposemCherry ControlDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertmCherry
UseAAVPromoterEf1aAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (D210N)
Plasmid#196703PurposePlasmid for transient mammalian expression of catalytically inactive RNase H1 mutant.DepositorInserthuman RNaseH1 D210N
ExpressionMammalianMutationD210N, catalytically inactiveAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH
Plasmid Kit#1000000163PurposeBRET biosensor plasmids encoding alpha, beta, or gamma subunits of the heterotrimeric G protein complex for detection of heterotrimer dissociation.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT3-N90-beta-catenin
Plasmid#31785DepositorInsertbeta-catenin (CTNNB1 Human)
TagsMycExpressionMammalianMutationDeletion of aa 1-90- Constitutitvely ActivePromoterEF1alphaAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-APOBEC1-YTH
Plasmid#131636PurposeExpresses APOBEC1 fused to the YTH domainDepositorAvailable SinceOct. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-ALDH1A1
Plasmid#189749PurposeThe construct was used to express recombinant ALDH1A1 in E.Coli. The purified protein was used for activity assay.DepositorAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXW7alpha
Plasmid#236470Purposetransient overexpression of FBXW7alpha in mammalian cellsDepositorInsertFBXW7alpha (FBXW7 Human)
ExpressionMammalianAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXspuro-GFP-NBR1
Plasmid#74202PurposeRetroviral expression of GFP-NBR1DepositorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSynSRE-T-Luc
Plasmid#60444PurposeUses the hamster HMG-CoA synthase promoter sequence (-324/-225) and minimal HMG-CoA sythnase TATA box (-28/+39) to study SREBP-dependent transcriptional activation.DepositorInsertHMG-CoA synthase promoter (-324/-225)
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterHMG-CoA synthase (-324/-225) & TATAA (-28/+39)Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1658-dCas9-EGFP
Plasmid#51023PurposeTemplate for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system)DepositorInsertdCas9 fuse to EGFP
UseCRISPR and RetroviralTagsEGFPExpressionMammalianPromoterMSCV LTR promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.cTNT.iCre (AAV9)
Viral Prep#69916-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.cTNT.iCre (#69916). In addition to the viral particles, you will also receive purified pAAV.cTNT.iCre plasmid DNA. cTnT driven in vivo expression of Cre and tdTomato (separated by IRES sequence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterChicken cardiac troponin TTagstdTomatoAvailable SinceJuly 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
GAL4BD-VP16/pDON207
Plasmid#201230PurposeGAL4-VP16 transcription factorDepositorInsertGAL4BD-VP16
ExpressionPlantAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-pSFFV-dCas9-SunTag-P2A-BFP-dWPRE
Plasmid#122151PurposeExpresses dCas9-SunTag(24X) fusion and a fluorescent indicator BFP.DepositorInsertdCas9 fused to SunTag(24x)
UseLentiviralTags2xNLS-P2A-BFP and NLSExpressionMammalianPromoterSFFVAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
35S-VP16-GWY/pAM
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP (AAV5)
Viral Prep#50457-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-DIO-EGFP (#50457). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-EGFP plasmid DNA. hSyn-driven, Cre-dependent EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTP396
Plasmid#149336PurposeBacterial expression of His14-Biotin_acceptor_peptide-SUMOEu1-anti-GFP_nanobodyDepositorInsertanti-GFP nanobody
TagsBiotin acceptor peptide (Avi-tag), His14, and SUM…ExpressionBacterialAvailable SinceJuly 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cre-P2A-dTomato (AAV1)
Viral Prep#107738-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA. hSyn-driven expression of Cre and dTomato (physically separate). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsdTomato (physically separate, not a fusion protein)Available SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-Puro-TK-NLS-mTurq2-PCNA
Plasmid#118617PurposeLentiviral expression of mTurq2 tagged PCNADepositorInsertTK-NLS-mTurq2-PCNA (PCNA Human)
UseLentiviralTagsmTurq2ExpressionMammalianPromoterhPGKAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only