179,538 results
-
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 (AAV1)
Viral prep#100849-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 (#100849). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.NES-jRCaMP1b.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent NES-jRCaMP1b calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACAGW-ChR2-Venus-AAV (AAV1)
Viral prep#20071-AAV1PurposeReady-to-use AAV1 particles produced from pACAGW-ChR2-Venus-AAV (#20071). In addition to the viral particles, you will also receive purified pACAGW-ChR2-Venus-AAV plasmid DNA. CAG-driven, channelrhodopsin fused to Venus for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPublicationPromoterCAGGTagsVenusAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xFLAG-TEV-UBE2O
Plasmid#105718PurposeExpresses WT full length human N- terminally tagged UBE2ODepositorAvailable sinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1 FLAG-YY1
Plasmid#104396PurposeFLAG-YY1DepositorInsertYY1
TagsFLAGAvailable sinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDG461
Plasmid#100902PurposeSpCas9n (D10A Nickase mutant) with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-EGFPExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tau (wt) -VC
Plasmid#87369Purposeexpresses hTau fused to the C-terminal part of VenusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPT (MAPT Human)
Tagsc-terminal part of VenusExpressionMammalianPromoterCMVAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-tdMCP-YFP
Plasmid#99151PurposeExpresses dimeric MS2-coat binding protein tagged with YFP, 2nd generation lentiviral vectorDepositorInsertDimeric MS2-coat binding protein
UseLentiviralTagseYFPExpressionMammalianPromoterSFFVAvailable sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMaRSC
Plasmid#89189PurposeThe pMaRS plasmid is the same construct as pMaRSL274G, but contains a T2A-Mcherry sequence appended to the C-terminal of L274GMmMetRS.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFlag-L274G-T2A-mCherry (Mars1 Mouse)
Available sinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LVXN-Neo-NSD2
Plasmid#86010Purposeexpress wild-type NSD2 in mammalian cellsDepositorInsertNSD2 (NSD2 Human)
UseLentiviralTagsFlag tag D Y K D D D D KExpressionBacterialMutationK1002R (please see depositor comments below)PromoterCMVAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY026
Plasmid#84741PurposeExpresses huAsCpf1 and crRNA guideDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuAsCpf1
Tags3xHA and NLSExpressionMammalianPromoterCMVAvailable sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hSyn1-sypHy-RGECO
Plasmid#84078PurposeCombined fluorescent reporter for both presynaptic calcium influx and vesicle excoytosisDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsypHy-RGECO
ExpressionMammalianPromoterhSyn1Available sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUCP20T-E2Crimson
Plasmid#78473PurposeBroad range bacterial fluorescence labelingDepositorInsertE2-Crimson
ExpressionBacterialAvailable sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLgw V5-EcoDam
Plasmid#59210PurposeMammalian DamID control lentiviral vector for expression of V5-Dam onlyDepositorInsertEcoDam
UseLentiviral; DamidTagsV5ExpressionMammalianPromoterHeat Shock Minimal Promoter and heat shock minima…Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA3-HA-Akt1
Plasmid#73408PurposeExpresses human AKT1 with a N-terminus HA tagDepositorAvailable sinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL4.10-VEGFprom(-1000 to -1)
Plasmid#66128PurposeLuciferase-based reporter for VEGF promoter region (-1000 to -1 bp)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVascular Endothelial Growth Factor -A promoter region (VEGFA Human)
UseLuciferasePromoterVEGF -1000 to -1Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV hSyn FLExFRT mGFP-2A-Synaptophysin-mRuby
Plasmid#71761PurposemGFP and Synaptophysin-mRuby expression from Flp-expressing neuronsDepositorInsertsmGFP
Synaptophysin
UseAAVTagsPalmitoylation signal and mRubyAvailable sinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-Anillin
Plasmid#68027PurposeFull length Anillin rendered RNAi-resistant) in mammalian expression vector pEGFP-C1DepositorInsertAnillin (ANLN Human)
TagseGFPExpressionMammalianMutationsilent mutations at 798 5'-TGCC TCTTTGAATAAA…PromoterCMVAvailable sinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mRFP-FKBP12
Plasmid#67514PurposeFKBP12 onlyDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP12 (FKBP1A Human)
TagsmRFPExpressionMammalianPromoterCMVAvailable sinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYLsgRNA-AtU3d
Plasmid#66200Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorPromoterAtU3dAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFUGW-hGtACR1-EYFP
Plasmid#67795PurposeMammalian expression construct of human codon-adapted anion channelrhodopsin 1 from Guillardia theta fused in frame to EYFP via a NotI site in the pFUGW vector backboneDepositorInserthGtACR1
UseLentiviralTagsEYFPExpressionMammalianAvailable sinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMitoLOC
Plasmid#58980PurposeExpression of preCOX4-mCherry & preSU9-GFP for colocalisation analysis of yeast mitochondrilaDepositorInsertsmCherry
GFP
TagspreCOX4 and preSU9ExpressionYeastPromoterADH1 and MET17Available sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-GCN5
Plasmid#65386PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGCN5 (KAT2A Human)
TagsEmGFP and V5ExpressionMammalianMutationnonePromoterCMVAvailable sinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tet-inducible mCherry reporter
Plasmid#64128PurposePhotoactivatable transcription system. mCherry reporter under the control of a tet-inducible promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry
ExpressionMammalianPromoterTetOx13-CMVAvailable sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-VSVG
Plasmid#64084PurposeExpression vector for Vesicular Stomatitis Virus Indiana strain glycoprotein geneDepositorInsertVSV glycoprotein
ExpressionMammalianPromoterCAGAvailable sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSBbi-GN
Plasmid#60517PurposeSB-transposon with constitutive bi-directional promoter, one side: SfiI cloning site for GOI (contains filler DNA), other side: GFP and neomycin resistance geneDepositorTypeEmpty backboneUseTransposonExpressionMammalianPromoterEF1a/RPBSAAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL3-Basic-8x-gRNA-eGFP
Plasmid#60718PurposeeGFP reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
Available sinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
single polypeptide FPX biosensor for calcium ion
Plasmid#60887PurposeFPX biosensorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsingle polypeptide FPX biosensor for calcium ion
TagsHindIII siteExpressionMammalianPromoterCMVAvailable sinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
tol2-mpeg1-mcherry
Plasmid#58935Purposelabels macrophages with mcherryDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmpeg1-mcherry
Promotermpeg1Available sinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C3-Exo70
Plasmid#53761PurposepEGFP-C3 plasmid that expresses Exo70DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertExo70 (EXOC7 Human)
TagsGFPExpressionMammalianAvailable sinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCS-H2B-EGFP
Plasmid#53744PurposeContains human Histone H2B fused to EGFP in the pCS2+ expression vectorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthistone H2B (H2BC21 Human)
TagsEGFPExpressionMammalianPromotersimian CMV IE94Available sinceJune 27, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1 3xFlag IFIT1
Plasmid#53554Purposemammalian expression of IFIT1DepositorAvailable sinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA-3xFLAG-Pontin
Plasmid#51635PurposeMammalian expression of 3xFLAG tagged pontin, N-terminal.DepositorAvailable sinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-Hyg-NLS.EGFP.P2A.Cherry.CAAX
Plasmid#52421PurposeExpresses a polyprotein cleaved by peptide 2A into nuclear GFP and membrane located mCherryDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFusion NLS-EGFP-P2A-Cherry-CAAX
ExpressionMammalianPromoterCMVAvailable sinceApril 3, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMDC32B-AtMIR390a-B/c
Plasmid#51776PurposePlant expression vector (2x35S) for direct cloning of artificial microRNAs into Arabidopsis thaliana MIR390a precursorDepositorPublicationInsertAtMIR390a-B/c
UsePlant expressionMutationA. thaliana MIR390a precursor sequence including …Available sinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Nano-lantern/pcDNA3
Plasmid#51970Purposemammalian expression of Nano-lantern, a luminescent protein for high-speed single-cell and whole body imagingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNano-lantern
ExpressionMammalianMutationS257G in Rluc8Available sinceMarch 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA-HA-ER Y537S
Plasmid#49499PurposeExpresses HA-tagged ER Y537S mutant in mammalian cellsDepositorAvailable sinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Flag Depdc5 pRK5
Plasmid#46340DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDepdc5 (DEPDC5 Human)
TagsFlagExpressionMammalianMutationDiffers from Depdc5 isoform 1 by 10 amino acids …Available sinceJuly 16, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNLS-iRFP713
Plasmid#45468DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertiRFP713
Tagsnuclear localization signalExpressionMammalianMutationT2A, S13L, A92T, V104T, V114I, E161K, E193K, F198…PromoterCMVAvailable sinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHM6-Q23
Plasmid#40263DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHTT partial exon 1 Q23 (HTT Human)
Tags6x His and HAExpressionMammalianMutationexpanded poly-QPromoterCMVAvailable sinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-ERK2
Plasmid#37145DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertERK2 (MAPK1 Rat)
TagsEGFPExpressionMammalianMutationaa1-6 deleted as a result of cloning strategyPromoterCMVAvailable sinceNov. 14, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
2.2
Plasmid#34885DepositorInsertSindbis virus envelope protein
UseLentiviralExpressionMammalianMutationSGN UTR in E1 domainPromoterCMVAvailable sinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMCP-Luc (MCP-1 promoter in pGL3-basic)
Plasmid#40324DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMCP-1 promoter (Ccl2 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationcontains MCP-1 promoter region through the nucleo…PromoterMCP-1Available sinceSept. 28, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA3 WT B-Myb
Plasmid#25965DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-Myb (MYBL2 Human)
ExpressionMammalianAvailable sinceAug. 22, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-MRLC1 T18D, S19D
Plasmid#35682DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMRLC1 (MYL9 Human)
TagsEGFPExpressionMammalianMutationT18D and S19DPromoterCMVAvailable sinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJMK004
Plasmid#34616PurposeViral expression of Arch (D95N mutant with greater sensitivity but slower response) voltage indicatorDepositorInsertArch D95N
UseLentiviralTagsGFPExpressionMammalianMutationChanged Aspartic Acid 95 to AsparaginePromoterCaMKIIAvailable sinceJan. 4, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJMK001
Plasmid#33780DepositorInsertProteorhodopsin Optical Proton Sensor
ExpressionBacterialMutationD97NPromoterAraBADAvailable sinceDec. 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1his p66shc (corrected)
Plasmid#32574DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertp66shc (SHC1 Human)
TagsHisExpressionMammalianPromoterCMVAvailable sinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by