We narrowed to 7,237 results for: ALP
-
Plasmid#64624Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertMAPK14 (transcript variant 2) (MAPK14 Human)
UseLentiviralTagsV5ExpressionMutationPromoterPGKAvailable sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-AID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta F-Box
Plasmid#197452PurposeThe plasmid expresses F-box deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression of FBW7alpha delta-F-Box and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
UseTagsMycExpressionMammalianMutationFBW7 Fbox deleted.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag PIP5K1A
Plasmid#20580DepositorInsertPIP5K1A (PIP5K1A Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorUseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag_HsIRE1a_deltaP29_D408_K599A_pBabePuro
Plasmid#58492Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant human IRE1a deleted from amino acids P28 to D408 and bearing mutation K599A (kinase domain mutant)DepositorInsertIRE1a (ERN1 Human)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationdeleted amino acids P29 to D408 and bearing mutat…PromoterAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_WT
Plasmid#81901PurposeGateway Donor vector containing NRAS , part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-COMP5AP-AviTag-9xHis
Plasmid#157384PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertFCGRT (FCGRT Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMH003_phiC31_neo-5xTetO-pEF-H2B-mCitrine-coreHS4-pRSV-H2B-mCherry
Plasmid#179431PurposeDual fluorescent reporter construct with single core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-coreHS4-mch (SC)
UseTagsExpressionMammalianMutationPromoterpEF alpha, pRSVAvailable sinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PHKA2
Plasmid#23526DepositorInsertPHKA2 (PHKA2 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIG-721 CTLA4-GFP T124P
Plasmid#186126PurposeCTLA4 gene knockin with mutationDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationT124PPromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_RARA_WT_V5
Plasmid#83018PurposeGateway Donor vector containing RARA , used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorInsertRARA (RARA Human)
UseGateway entry vectorTagsExpressionMutationPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.Q61L
Plasmid#81674PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationQ61LPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSt1374-N-NLS-DNMT3L-L-DNMT3A-L-dcas9-NLS
Plasmid#112210PurposeTargeted DNA methylationDepositorUseCRISPRTagsExpressionMutationD10A,H840A,N863APromoterAvailable sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
cmamxA2-GFP
Plasmid#107197PurposeExpresses human annexin A2-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A2 (ANXA2 Human)
UseTagsGreen Fluorescent ProteinExpressionMammalianMutationall type II Ca2+ binding sites deleted ( D161A, E…PromoterCMVAvailable sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TLK2
Plasmid#23629DepositorInsertTLK2 (TLK2 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIG-648 CTLA4int1-CTLA4-GFP-SV40
Plasmid#186123PurposeCTLA4 gene knockinDepositorInsertCTLA4 (CTLA4 Human)
UseCRISPRTagsExpressionMutationWT with GFP sequencePromoterAvailable sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-836_NY-ESO-1_TCR_FAS/OX40
Plasmid#207499PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/OX40, NY-ESO-1_TCR (FAS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
KHBD00370
Plasmid#34485DepositorInsertCG8409 (Su(var)205 Fly)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNF-Fc(DAPA)-AviTag-6xHis
Plasmid#156575PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertTNF (TNF Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pCAGGS
Plasmid#206115Purposeexpression of rat Cav2.1 with an exofacial double HA tag in domain II and mutations in the P loop of Domains I, II, III and IV which abolish trafficking to the cell surfaceDepositorInsertcacna1b (Cacna1a Rat)
UseTagsExpressionMammalianMutationE320A, E670A, E1411A, E1707APromoterCMV/B-actinAvailable sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.1 HA EI,II,III,IVA (E320A, E670A, E1411A, E1707A) pcDNA3
Plasmid#206121Purposeexpression of rat Cav2.1 calcium channel with a E1686R mutation to enhance expression and a mutation in the P loop of Domains I, II, III and IV to to abolish divalent cation bindingDepositorInsertcacna1a (Cacna1a Rat)
UseTagsExpressionMammalianMutationE320A, E670A, E1411A, E1707APromoterCMVAvailable sinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001149372)
Plasmid#77033Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorInsertCHUK (CHUK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001149269)
Plasmid#77034Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorInsertCHUK (CHUK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIG-833_NY-ESO-1_TCR_FAS/CD28
Plasmid#207496PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertFAS/CD28, NY-ESO-1_TCR (FAS Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.G12C
Plasmid#81660PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationG12CPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-TNFRSF19-Fc(DAPA)-AviTag-6xHis
Plasmid#156533PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertTNFRSF19 (TNFRSF19 Human)
UseTagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.Q61H
Plasmid#81670PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationQ61HPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.mIKKα
Plasmid#74413PurposeExpresses mouse eGFP-IKKα in mammalian cellsDepositorInsertmouse IKKα (Chuk Mouse)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable sinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187963PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertsAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linker and T2AExpressionMammalianMutationPromoterAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_p.G12A
Plasmid#81664PurposeGateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.DepositorInsertNM_002524.4 (NRAS Human)
UseGateway entry vectorTagsExpressionMutationG12APromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cav3.1 Ca2+ channel [N178A/9.1R]
Plasmid#114520PurposeMammalian Expression Plasmid of anti-Cav3.1 Ca2+ channel (Mouse). Derived from hybridoma N178A/9.1.DepositorInsertanti-Cav3.1 Ca2+ channel (Mus musculus) recombinant mouse monoclonal antibody (Cacna1g Mouse)
UseTagsExpressionMammalianMutationPromoterdual CMVAvailable sinceFeb. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MAPK9_WT
Plasmid#82230PurposeGateway Donor vector containing MAPK9 , part of the Target Accelerator Plasmid Collection.DepositorInsertMAPK9 (MAPK9 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
CHUK gRNA (BRDN0001148194)
Plasmid#77035Purpose3rd generation lentiviral gRNA plasmid targeting human CHUKDepositorInsertCHUK (CHUK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorUseTags13xMyc, Flag, and HAExpressionMammalianMutationPromoterCMVAvailable sinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
JNK2 WT O/E (MAPK9)-pcw107-V5
Plasmid#64617Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertMAPK9 (transcript variant JNK2-a2) (MAPK9 Human)
UseLentiviralTagsV5ExpressionMutationnonePromoterPGKAvailable sinceNov. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NME6
Plasmid#23562DepositorInsertNME6 (NME6 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag RPS6KA6
Plasmid#20623DepositorInsertRPS6KA6 (RPS6KA6 Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-RPS6KA6
Plasmid#23540DepositorInsertRPS6KA6 (RPS6KA6 Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_NRAS_WT
Plasmid#82150PurposeGateway Donor vector containing NRAS , part of the Target Accelerator Plasmid Collection.DepositorInsertNRAS (NRAS Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MAPK14_WT
Plasmid#82298PurposeGateway Donor vector containing MAPK14, part of the Target Accelerator Plasmid Collection.DepositorInsertMAPK14 (MAPK14 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag_MmPERK_S503_N1114_pBabePuro
Plasmid#58423Purposeretroviral pBabe puro vector encoding N-terminally FLAG tagged mutant mouse PERK deleted from amino acids M1 to Y502. The remaining amino acids are S503 to N1114.DepositorInsertPERK (Eif2ak3 Mouse)
UseRetroviralTagsFLAG and preprotrypsin signal sequenceExpressionMammalianMutationDeleted amino acids M1 to Y502PromoterAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIG-AVITEV- hNFATc1/aA
Plasmid#74057Purposeretroviral expression plasmid for human NFATc1/aA with N-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc1, isoform alpha-A (NFATC1 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianMutationmutation G1157A [R235Q] and the silent mutation C…PromoterpMSCV-LTRsAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
R713-M52-303: CMV51p> Halotag-NRasHVR
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorInsertHalotag-NRasHVR (NRAS Human)
UseTagsHalotagExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NLS (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag CSNK1A1L
Plasmid#20467DepositorInsertCSNK1A1L (CSNK1A1L Human)
UseRetroviralTagsFlag and MyrExpressionMammalianMutationPromoterAvailable sinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
UseTagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only