We narrowed to 15,152 results for: GRN
-
Plasmid#76189Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1A1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146195)
Plasmid#76082Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK3 gRNA (BRDN0001147667)
Plasmid#75968Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001144943)
Plasmid#75942Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147294)
Plasmid#75916Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001145847)
Plasmid#75917Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK4 gRNA (BRDN0001147521)
Plasmid#75877Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK6 gRNA (BRDN0001145692)
Plasmid#75643Purpose3rd generation lentiviral gRNA plasmid targeting human CDK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PTK2 gRNA (BRDN0001148426)
Plasmid#75545Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–EgRNA
Plasmid#62716PurposeEmpty; no U6 gRNA cassetteDepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #1
Plasmid#61515Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgcggcagctcctagctcagc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with rpr-1 promoter
Plasmid#48961Purposeto drive the sgRNA expression under RNase P non-coding RNA promoterDepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterrpr-1 promoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0007
Plasmid#42247PurposegRNA targeted to zebrafish gene th1DepositorAvailable SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti X2 Blast/shp16 (w112-1)
Plasmid#22261DepositorInsertsh cyclin-dependent kinase inhibitor 2A
UseLentiviral and RNAiAvailable SinceDec. 15, 2009AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 2 tet pLKO puro
Plasmid#162984PurposeTet-inducible shRNA targeting human METTL3 #2DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
MDH1-PGK-GFP-miR9
Plasmid#25036DepositorAvailable SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLV.PARP1#5
Plasmid#14548DepositorAvailable SinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pXPR_502_sgCD4
Plasmid#158704PurposeCD4 CRISPRa controlDepositorInsertCD4 (CD4 Human)
UseLentiviralAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA_Tet3
Plasmid#85740PurposeshRNA against mouse Tet3DepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiviral shRNA GEF-H1
Plasmid#21477DepositorInsertrho/rac guanine nucleotide exchange factor (GEF) 2 (Arhgef2 Rat)
UseLentiviralTagseGFPExpressionMammalianAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBHM2329
Plasmid#171686PurposepRS316-PCnU6-scaffold, contains template for amplification of PCnU6 and scaffold for fusion PCRDepositorInsertPCnU6-sgRNA_scaffold
UseCRISPRExpressionBacterial and YeastPromoterC. neoformans U6Available SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pG1
Plasmid#162602PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-mCh-Oct4i
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-3'UTR
Plasmid#136036PurposeUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-BAR
Plasmid#126072PurposeFor CRISPR/Cas9 delivery in maize. Expresses Cas9 with rice ubiquitin promoter, BAR with 35S promoter, and sgRNA/PTG with rice snoRNA U3 promoter (pol III). Can produce 1 or more gRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoter35S for BAR; Rice UBI for Cas9; Rice snoRNA U3 fo…Available SinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302-SunTagng-22aa
Plasmid#115345PurposeEncodes a SunTag CRISPR cas9 system that does not contain a guide RNA and therefore, does not target the TET1 catalytic domain to any specific region of the genomeDepositorInsertNOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
act-AsCpf1
Plasmid#73917Purposeexpression plasmid of AsCpf1DepositorInserthAsCpf1
TagsNLS-3xHAExpressionInsectPromoteract5CAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOsU3
Plasmid#170132PurposeFor sgRNA expression in monocotyledons protoplastsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
sh-RNA hAtg13
Plasmid#31971DepositorAvailable SinceSept. 30, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-LNGFR-FF3
Plasmid#11666Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of LNGFR and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsLNGFRExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.PKD3.RNAi
Plasmid#10818DepositorAvailable SinceOct. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pMB60
Plasmid#47941PurposeCan be used to generate synthetic guide in vitro from T7 promotorDepositorInsertsynthetic guide RNA
UseCRISPRExpressionWormAvailable SinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
Fragment1 with TLS2
Plasmid#196983PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.DepositorInsertIntermediate fragment for assembly of gRNA-TLS2 construct
UseGateway CloningAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-FOXM1-shRNA-81
Plasmid#89495PurposeLentiviral vector with constitutive expression of shRNA targeting human FOXM1.DepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCBh_3x Flag-NLS-enRhCas12f1-NLS_pA_phU6_gRNA scaffold-spacer_pCMV_mCherry_pA
Plasmid#197027PurposeVector encoding a human codon-optimized enRhCas12f1 driven by CBh promoter, guide RNAs compatible with enRhCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized enRhCas12f1
ExpressionMammalianMutationL270RPromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEM320 - sgRNA mosTI unc-119 array insertion
Plasmid#159824PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 array insertion
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgKEAP1-2
Plasmid#186459Purposeknock out KEAP1 in mammalian cellsDepositorInsertKeap1 (Kelch-like ECH-associated protein 1) (KEAP1 Human)
UseCRISPR and LentiviralAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-STAG2 shRNA 3782
Plasmid#31979DepositorAvailable SinceAug. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS-puro shNEDD4L #1
Plasmid#27016DepositorAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pSuperRetro-EFP siRNA2
Plasmid#12450DepositorAvailable SinceJan. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2518
Plasmid#91075PurposeModule B, Promoter: TaU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N
Plasmid#164907PurposeExpress a pegRNA targeting SERPINA1, and a nicking sgRNA and the N-terminal split-intein fragment of PE2DepositorInsertpegSERPINA1, Nicking sgRNA, PE2-N
UseAAVAvailable SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21A
Plasmid#91128PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD3_1
Plasmid#36371DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLV.PARP1#4
Plasmid#14547DepositorAvailable SinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only