We narrowed to 35,584 results for: CaS;
-
Plasmid#155186PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA2DepositorInsertCas13d RUNX1 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 SOX17 g1
Plasmid#155187PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and SOX17 gRNA1DepositorInsertCas13d SOX17 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Equalizer-M plasmid with onboard mCherry cassette
Plasmid#169734PurposeEqualizer-M plasmid that encodes eGFP to report circuit output levels. This plasmid also encodes a separate mCherry expression cassette to monitor plasmid dosage.DepositorInserttetR-P2A-eGFP-miR(FF4) target-miR(FF4)
UseSynthetic BiologyExpressionMammalianPromoterCMV-tetO2Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS11: pTns(AvCAST)_ΔTniQ,ΔTnsD
Plasmid#168144PurposeInducible expression of AvCAST TnsA, TnsB and TnsC proteins.DepositorInsertAvCAST Tns proteins (TnsA, TnsB and TnsC)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 nickase D10A Cas9 (GB1691)
Plasmid#160588PurposeNickase D10A Cas9 for Nt fusion.DepositorInsertnickase D10A Cas9
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCbh-SpyCas9-2A-puro-pA_U6-sgRosa26
Plasmid#149346PurposeMammalian expression vector for SpyCas9, puromycin resistance and mouse Rosa26 guide RNADepositorInsertCas9
UseCRISPRTagsFlag tagExpressionMammalianPromoterCbcAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCbh-SpyCas9-2A-puro-pA_U6-BbsI
Plasmid#149347PurposeMammalian expression vector for SpyCas9 and puromycin resistanceDepositorInsertSpyCas9
UseCRISPRTagsFlag tagExpressionMammalianPromoterCbhAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp1
Plasmid#159919PurposeMutagenesis of Vamp1DepositorInsertVamp1 (Vamp1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgNtn1
Plasmid#159907PurposeMutagenesis of Netrin1DepositorInsertNetrin1 (Ntn1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgDcc
Plasmid#159906PurposeMutagenesis of DccDepositorInsertDcc (Dcc Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LP102: pMAGIC (R4-R3) NLS-Sp Cas9-NLS
Plasmid#132927PurposepMAGIC R4-R3 entry plasmid, contains 2xNLS SpCas9 (nuclease active) for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInserthumanized SpCas9
UseCRISPR and Synthetic Biology; Pmagic gateway entr…Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Drosophila Nedd2-like caspase (DRONC)
Plasmid#157778PurposeE. coli expression vector pET23 with C-term 6xHis tagDepositorInsertDrosophila Nedd2-like caspase (DRONC) (Dronc Fly)
Tags6x HISExpressionBacterialPromoterT7Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L3-Csy4-FokI-dCas9-EGFP-L2
Plasmid#141047PurposeMutisite Gateway mediated vector constructionDepositorInsertCsy4-2A-FokI-dCas9-2A-EGFP
ExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
IH601: pMAGIC (R4-R3) NLS-Sa Cas9-NLS
Plasmid#121827PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS SaCas9 (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-Cas9 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3H HapII R175/6E-Cas9n-UGI
Plasmid#119142PurposeBase editor made from APOBEC3H Haplotype II RNA binding mutant RR175/6EEDepositorInsertAPOBEC3H Haplotype II RR175/6EE-Cas9 nickase-UGI
UseCRISPRMutationA3H Hap II RR175/6EEPromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
MEI-S332-GFP genomic in pCaSpeR
Plasmid#113174PurposeIn P element vector for transposon insertion into Drosophila genomeDepositorInsertmei-S332 (Sgo)
UseP insertion vectorTagsGFPAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A+K855A
Plasmid#108299PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-zwf
Plasmid#87152PurposegltA1-gltA2-udhA-zwf targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-zwf guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2-udhA-GapAP1
Plasmid#87151PurposegltA1-gltA2-udhA-GapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2-udhA-GapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-fabI-gltA1-gltA2-gapAP1
Plasmid#87147PurposefabI-gltA1-gltA2-gapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertfabI-gltA1-gltA2-gapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, Synthetic, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAD05 S. castellii telomerase RNA KBS
Plasmid#61894PurposePlasmid for run-off in vitro transcription of Saccharomyces castellii KBS RNADepositorInsertTelomerase RNA hairpin
PromoterT7Available SinceMarch 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
RCAS (B) flag Radical Fringe (CT#472)
Plasmid#13983DepositorAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpCas9-NG-P2A-EGFP (RTW4554)
Plasmid#140001PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9-NG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianPromoterCAGAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196084Purpose(Empty Backbone) Inducible CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-CasRX-P2A-EGFP-BGH PolyA
Plasmid#154004PurposeExpress CasRxDepositorInsertCasRx
UseCRISPRPromoterCAGAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-coBxb1-2A-BFP_IRES-iCasp9-2A-Blast_rtTA3
Plasmid#171588PurposeLentivector encoding a DNA recombinase landing pad with Bxb1 integrase and iCasp9 negative selection behind a Tet-inducible promoterDepositorInsertsBxb1 integrase
iCasp9
BFP
rtTA3G
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i
Plasmid#233080PurposeExpression vector for sgRNA-S1b and eCas12f1iDepositorInsertU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1i-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1
Plasmid#233078PurposeExpression vector for sgRNA-S1b and eCas12f1DepositorInsertU6-sgRNA-S1b (BsaI)-CBh-bpNLS-eCas12f1-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-miR122 TS
Plasmid#209783PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoter, incorporation of the miR122 target sequences (miR122TS) into the 3’ untranslated region (3’ UTR)DepositorInsertmiR122 ts
UseAAVTagsHAPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5428_pHR_EF1a-mCherry-P2A-Rfx_Cas13d-2xNLS-3xFLAG
Plasmid#155305PurposeLentiviral vector encoding Rfx Cas13d fused with 2xNLS, 3xFLAG, and 2A-tagged mCherry.DepositorInsertmCherry 2A-tagged to Ruminococcus flavefaciens XPD3002 Cas13d
UseLentiviralTags2xNLS-3xFLAGExpressionMammalianPromoterEF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-dCas9-VPR-pgk-hph
Plasmid#233066PurposePiggybac CRISPRa constructDepositorInsertdCas9-VPR
UseCRISPRAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-dCas9 KRAB-T2A-GFP
Plasmid#67620PurposeCo-expressed human optimized S. pyogenese dCas9 fused to KRAB repressor domain and GFPDepositorInserthumanized dead Cas9 KRAB T2A GFP
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-KRAB-dCas9-P2A-mCherry
Plasmid#60954Purpose2nd Generation Lentiviral vector. Expresses an N-terminal KRAB-dCas9 fusion protein and mCherryDepositorInsertKRAB-dCas9-P2A-mCherry fusion
UseCRISPR and LentiviralTags2x NLS, HA, KRAB domain, and mCherryExpressionMammalianPromoterSFFVAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE
Plasmid#85452PurposeLentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker.DepositorInsertU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro
UseCRISPR and LentiviralTagsNLSExpressionMammalianAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978)
Plasmid#185910PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-BFP-PGK-Blast
Plasmid#196720PurposeTet-inducible expression of Cas9-T2A-TagBFPDepositorInsertCas9-T2A-TagBFP
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSPromoterTRE, PGKAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP
Plasmid#64323PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-EBFP2ExpressionMammalianPromoterCBh and U6Available SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fuw-dCas9-dead Tet1CD-P2A-BFP
Plasmid#108246PurposeLentiviral vector to express dCas9-dead Tet1CD-P2A-tagBFPDepositorInsertdCas9-dead Tet1CD-HA-P2A-BFP
UseLentiviralTagsHAExpressionMammalianMutationdCas9-D10A, dCas9-H840A, Tet1CD-H1672Y, Tet1CD-D1…PromoterUbcAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-dCas9-CBio-IRES-zsGreen1
Plasmid#138418PurposeCAPTURE2.0 vector containing dCas9-CBio, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagPromoterEF1aAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC016 - LwCas13a guide expression backbone with U6 promoter
Plasmid#91906PurposeBackbone for cloning LwCas13a guides under U6 promoterDepositorHas ServiceCloning Grade DNAInsertLwCas13a Guide site
ExpressionMammalianAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXR004: CasRx pre-gRNA cloning backbone
Plasmid#109054PurposehU6-driven expression of guide RNAs compatible with CasRx. Contains BbsI sites for guide cloning flanked by 5' and 3' full-length DRsDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only