We narrowed to 15,152 results for: GRN
-
Plasmid#64158PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA2 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA2 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEG302-SunTag-FWAgRNA-4-22aa-TET1cd
Plasmid#115344PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the FWA promoterDepositorInsertgRNA4_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1812_pCR8-gCasRx-CUG (control gRNA)
Plasmid#118645PurposeTransient transfection; Expressed Control (CUG repeat) CasRx gRNA; Gateway DonorDepositorInsertgCasRx-CUG
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145598)
Plasmid#80173Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW1259
Plasmid#61251PurposeCas9 plasmid with sgRNA deleted; for use in C. elegansDepositorInsertDeletion
UseCRISPRExpressionWormMutationDeleted sgRNA(F+E) sequence from pJW1219Available SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUPER TBK1
Plasmid#26210DepositorInsertpSUPER TBK1 (TBK1 Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-NLS-dCas9-HA-2XNLS-10xGCN4-NLS-P2A-scFv-NLS-P65-HSF1-Flag-WPRE-PolyA-PGK-EM7-NeoR-polyA
Plasmid#168290PurposeCRISPR-activator Suntag-P65-HSF1 (SPH)DepositorInsertdCas9, Suntag-P65-HSF1
ExpressionMammalianPromoterCAGAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSico Dnmt1
Plasmid#12165PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating Dnmt1 shRNA expression.DepositorInsertDnmt1 shRNA (Dnmt1 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-BFP
Plasmid#188776PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shRen.713
Plasmid#186712PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Non-targeting control shRNA (shRen.713).DepositorInsertshRen.713
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-full-length-sgRNA
Plasmid#204638PurposeExpression of full-length AsCas12f sgRNA in mammalian cellsDepositorInsertfull-length AsCas12f sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWS3799-gRNA-Csy4-template
Plasmid#182827PurposeSpCas9 gRNA-Csy4 templateDepositorInsertSpCas9 gRNA scaffold + Csy4 sequence
UseCRISPRAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto
Plasmid#167904PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP109 pEF1a-gRNA-GFP
Plasmid#100935PurposeGFP, puromycin and gRNA scaffold driven by EF1a promoterDepositorInsertgRNA scaffold
UseGrna scaffoldExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-(BbsI)sgRNA_CAG-Venus-bpA
Plasmid#86985PurposeFor cloning and expression of sgRNA together with Venus expressionDepositorInsertVenus
ExpressionMammalianMutationVenus GFP variantPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chr7_Centromere-Targeting_gRNA
Plasmid#195129Purposedual gRNA vector targeting centromere-proximal locations on Chromosome 7p and 7q in a third generation Cas9 backbone with GFPDepositorInsertChr7 gRNA
ExpressionMammalianAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA-ROSA26_hspCas9
Plasmid#193310PurposeCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6 ROSA26 sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
MYH11-gRNA1
Plasmid#132587PurposegRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )DepositorInsertMYH11-gRNA1
ExpressionBacterialAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AksgRNA
Plasmid#121955PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAkCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
WT1 KI gRNA2
Plasmid#92313PurposeCRISPR-GFP-gRNA for cutting WT1DepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3041(gRNA X-3)
Plasmid#73283PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Construct 10 - U6p_40nt_stgRNA
Plasmid#81249PurposeExpresses 40nt stgRNADepositorInsertsgRNA
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12
Plasmid#61079PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pM123: pAAV-EFS-CasRx-control presgRNA
Plasmid#166871PurposeAAV vector for expressing CasRx and control presgRNA for RNA-editingDepositorInsertsU6-control presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFP
Plasmid#86987PurposeFor cloning and expression of sgRNA together with expression of Cas9 and TagRFPDepositorInsertCas9
ExpressionMammalianPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-YY1_1
Plasmid#36357DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEM040 [Multiome Perturb-seq sgRNA expression vector]
Plasmid#224898PurposeLentiviral CROP-seq vector with lineage barcode cassette and T7 promoter for ID amplification from cDNA, engineered for high-efficiency ID assignment in Multiome Perturb-seq experimentsDepositorInsertseGFP
LacZ fragment (removed by digestion with BstXI/BlpI for sgRNA cloning)
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEP179_pX330K
Plasmid#137882PurposeEntry vector for multi-gRNA cloningDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6T7
Plasmid#71462PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (2 Gs at initiation)DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterhuman U6/phage T7Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
shCTNNB1 # 2
Plasmid#42544DepositorAvailable SinceFeb. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBBR-Cas9ΔyqhD-HA500
Plasmid#220369PurposeA single-plasmid-based, easily cured CRISPR/Cas9 system for genome engineering in Pseudomonas putida KT2440DepositorInsertsSpCas9
sgRNA for yqhD in P. putida KT2440
UseCRISPR; Broad host rangeExpressionBacterialAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse Dicer3
Plasmid#14778DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pS-cr:GFP
Plasmid#196295Purpose35S promoter-driven expression of the positive-sense TSWV S RNA segment encoding crRNA:GFP fusion in place of the NSsDepositorInsertFull length TSWV S antigenome encoding crRNA:GFP fusion in place of viral NSs
UseCRISPRTagsSpeI-DR-BsaI-DR-SpeIExpressionPlantPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Hsa
Plasmid#128175PurposeDoxycyclin inducible shRNA knockdown of human cGAS geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSpuro shID1#6
Plasmid#19165DepositorInsertsmall hairpin RNA against inhibitor of DNA binding 1 (ID1 Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceOct. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-Puro-shPP2A-Abeta
Plasmid#15250DepositorInsertPP2A regulatory subunit A, beta isoform (PPP2R1B Human)
UseRNAi and RetroviralExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.PKD2.RNAi
Plasmid#10816DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pS448∙CsR
Plasmid#122096PurposeCRISPR/Cas9 counterselection in Gram-negative bacteriaDepositorInsertsCas9
sgRNA
UseSynthetic BiologyExpressionBacterialPromoterPem7 and PmAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only