173,361 results
-
Plasmid#20066PurposeBacterial expression of an extended membrane scaffold protein (MSP1E3D1) for Nanodisc formationDepositorInsertMSP1E3D1
Tags7-HisExpressionBacterialMutation"extended" MSP1D1; contains repeats of …Available SinceJan. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRK793
Plasmid#8827DepositorInsertTEV protease, S219V mutant
TagsHis, MBP (with TEV), and polyarginineExpressionBacterialMutationS219V mutation (improves stability)Available SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
PB-GFP-Gal8
Plasmid#127191PurposePiggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.DepositorInsertGFP-Gal8 (LGALS8 Human)
TagsGal8 is fused to the c-terminus of GFPExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-eGFP
Plasmid#36083Purpose3rd generation lentiviral transfer plasmidDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceJune 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV2)
Viral Prep#50465-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4A
Plasmid#224448PurposeRep/Cap plasmid for the production of MyoAAV 4A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYNSL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF.STAT3DN.Ubc.GFP
Plasmid#24984PurposeDepositorInsertSTAT3 (STAT3 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationY705F--dominant negativeAvailable SinceJune 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
CFTR-HiBiT Fusion Vector
Plasmid#236890PurposeExpress CFTR WT HiBiT in Mammalian Cells under a CMV promoterDepositorAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMax_GFP
Plasmid#177825PurposeHost Cell Reactivation (HCR) control GFP plasmid (pMax backbone)DepositorInsertGFP
ExpressionMammalianPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.rTH.PI.Cre.SV40 (AAV9)
Viral Prep#107788-AAV9PurposeReady-to-use AAV9 particles produced from AAV.rTH.PI.Cre.SV40 (#107788). In addition to the viral particles, you will also receive purified AAV.rTH.PI.Cre.SV40 plasmid DNA. rTH promoter driving Cre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterrTHAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMVR8.74
Plasmid#22036Purpose2nd generation lentiviral packaging plasmid. Can be used with 2nd or 3rd generation lentiviral vectors and envelope expressing plasmid (Addgene#12259)DepositorInsertgag pol tat rev
ExpressionMammalianAvailable SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1
Plasmid#83842PurposeFluorescent probe for S/G2 transition and G2/M transition, one of two plasmids for the FUCCI4 systemDepositorUseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAS-NanoLuc
Plasmid#87696PurposeGal4VP16 driven expression of NanoLucDepositorInsertNanoLuc
Tagsnuclear localization signalExpressionMammalianAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-AMPKAR
Plasmid#192446PurposeGenetically encoded excitation-ratiometric fluorescent biosensor for monitoring AMPK activity in living cells.DepositorInsertExRai-AMPKAR
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianPromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRVL-5
Plasmid#104583PurposeContains human IgG1 CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-4
Plasmid#104582PurposeContains human kappa CL domain, for cloning of antibody VL domains using SapI restriction enzyme.DepositorInsertHuman CL kappa
ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4440
Plasmid#1654DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAiTagsT7p, T7p, lacZN, OriF1>>, OriF1<<ExpressionWormAvailable SinceMarch 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His hTFNG
Plasmid#67240PurposeExpresses N-His tagged nonglycosylated human serum transferrin in mammalian cellsDepositorInserthuman serum transferrin (TF Human)
TagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationAsn413 Asp, Asn611AspPromoterSV40Available SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#100843-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.Syn.GCaMP6s.WPRE.SV40 (#100843). In addition to the viral particles, you will also receive purified pAAV.Syn.GCaMP6s.WPRE.SV40 plasmid DNA. Syn-driven GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP
Plasmid#11680DepositorAvailable SinceMay 31, 2006AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo
Plasmid#139449PurposeLentiviral vector with gRNA scaffold and neomycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Vimentin-pLJM5
Plasmid#189868PurposeExpresses human Vimentin in mammalian cellsDepositorInsertVimentin
Tagsm-CherryExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1)
Plasmid#17452Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, PuroDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Destination vectorExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV1)
Viral Prep#162377-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
mAIRN HO
Plasmid#207411PurposeMammalian-cell-based plasmid system that expresses mAIRN (an R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertmAIRN
ExpressionBacterial and MammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
mAIRN CD
Plasmid#207412PurposeMammalian-cell-based plasmid system that expresses mAIRN (an R-loop-forming transcript) upon dox-induction, which will further cause co-directional transcription-replication conflict (CD TRC).DepositorInsertmAIRN
ExpressionBacterial and MammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
ECFP HO
Plasmid#207413PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
ECFP CD
Plasmid#207414PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause co-directional transcription-replication conflict (CD TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP2-96-merTetO-EFS-BLaR
Plasmid#118713PurposeContains an optimized 96-mer TetO repeat for imaging of desired lociDepositorInsertsBlasticidin resistance gene
EFS-NS promoter
ExpressionMammalianPromoterEFS-NSAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-CMV-bArrestin2-TEV
Plasmid#107245PurposeVector for preparation of stable cell lines expressing Barrestin2-TEV fusion protein in lieu of the HTLA cell line.DepositorInsertARRB2
TagsTEV(NIA), tobacco etch virus NIAExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hChR2(H134R)-mCherry (AAV9)
Viral Prep#26976-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hChR2(H134R)-mCherry (#26976). In addition to the viral particles, you will also receive purified pAAV-hSyn-hChR2(H134R)-mCherry plasmid DNA. Synapsin-driven, humanized channelrhodopsin H134R mutant, fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4_CRE-CMVmin-luc2
Plasmid#194384PurposeReporter plasmid for cAMP/Calcium assays; firefly luciferase reporter gene driven by 6x clustered CRE binding sites linked to a minimal CMV promoterDepositorInsert6xCRE-CMVmin-luc2
ExpressionMammalianPromoterCMV minimalAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOS007: PercevalHR ATP/ADP sensor (cytosolic)
Plasmid#163061PurposePercevalHR ATP/ADP sensor (cytosolic)DepositorInsertPercevalHR
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV Retrograde)
Viral Prep#112677-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-AMPKAR(T/A)
Plasmid#192447PurposeNon-phosphorylatable negative-control mutant of ExRai-AMPKAR.DepositorInsertExRai-AMPKAR(T/A)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianMutationThr 6 in AMPK substrate mutated to Ala.PromoterCMVAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS406-Padh-OsTIR1(F74G)
Plasmid#247604PurposeExpression of OsTIR1DepositorInsertOsTIR1
ExpressionYeastMutationF74GPromoterADH1Available SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDx_mScarlet-I3
Plasmid#189757PurposeDual expression vector for bacteria and mammalian cells producing mScarlet-I3 red fluorescent proteinDepositorInsertmScarlet-I3
Tags6xHisExpressionBacterial and MammalianPromoterCMV & RhaAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MORF Library Kit with GFP and mCherry controls
Pooled Library#1000000218DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-puro_GCaMP6s
Plasmid#164589PurposeStable integration and expression of GCaMP6s in mammalian cellsDepositorInsertGCaMP6s
UseLentiviralTags6xHis, T7 tag, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1362 scFv entry plasmid
Plasmid#201912PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)DepositorInsertStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKC105_pLenti_TetON_PABPC1_INT
Plasmid#242110PurposeTet- or Dox-inducible expression of PABPC1 fused to INT (human PARP4 fragment)DepositorInsertPAB4L, PARP4 fragment (PABPC1 Human)
UseLentiviralMutationPABPC1 aa 1-370, PARP4 aa 1562-1724PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
DLX2-hygro
Plasmid#97330PurposeGenerating lentiviruses to express Dlx2 and hygromycin resistanceDepositorAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUK21
Plasmid#49788PurposeE. coli cloning vector (KanR, high copy, blue/white selection, M13 IR)DepositorTypeEmpty backboneUseCloning vectorPromoterlacZAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (AAV Retrograde)
Viral Prep#100854-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (#100854). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven GECO1a calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-mCherry
Plasmid#188779PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9
UseLentiviralTagsZim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
SigmaR1-mNeonGreen
Plasmid#226566PurposeEncodes SigmaR1 protein labeled with mNeonGreenDepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFPGUSPlus
Plasmid#64401PurposeBinary plant vector expressing GFP and GUS, both driven by a 35S promoterDepositorInsertsGFP
GUSPlus
UseBinary vector for plant transformationTagsHisExpressionPlantMutationS65TPromoter35SAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only