169,450 results
-
Viral Prep#130991-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE (#130991). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-ChRmine-mScarlet-Kv2.1-WPRE plasmid DNA. CamKIIa-driven, soma-targeted ChRmine-mScarlet expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsmScarletAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only
-
lentiCas9-Blast (Lentiviral Prep)
Viral Prep#52962-LVPurposeReady-to-use Lentiviral Prep particles produced from lentiCas9-Blast (#52962). In addition to the viral particles, you will also receive purified lentiCas9-Blast plasmid DNA. Lentiviral particles carrying Cas9 and blasticidin resistance. This virus is used to make stable cell lines expressing Cas9.DepositorPromoterEFS-NSAvailable SinceJuly 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV9)
Viral Prep#44361-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-mt-mKeima
Plasmid#131626Purposelentiviral expression of mitochondrial mKeima for generation of stable cell linesDepositorInsertmt-mKeima
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCI SMN1
Plasmid#72286PurposeSMN1 exon 7 splicing cassetteDepositorAvailable SinceJan. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (AAV Retrograde)
Viral Prep#105540-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 (#105540). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 plasmid DNA. Expression of EGFP-Cre from hSyn promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-N-RAM-d2tTA-TRE-mKate2
Plasmid#140275PurposeN-RAM, the Npas4-dependent reporterDepositorInsertmKate2
UseAAVPromoterTREAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-NT*-HRV3CP
Plasmid#162795PurposeExpressess an optimized construct of human rhinovirus 14 3C protease (NT*-HRV3CP)DepositorInsertHuman rhinovirus 14 3C protease
TagsNT* solubility tagExpressionBacterialPromoterT7Available SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-GG-acceptor
Plasmid#174038PurposePrime editing in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1-SIO-stGtACR2-FusionRed (AAV1)
Viral Prep#105677-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_hSyn1-SIO-stGtACR2-FusionRed (#105677). In addition to the viral particles, you will also receive purified pAAV_hSyn1-SIO-stGtACR2-FusionRed plasmid DNA. Synapsin-driven, Cre-dependent, soma-targeted anion-conducting channelrhodopsin fused to FusionRed for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsFusionRed (Cre-dependent)Available SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV GFP Hygro (656-4) (Lentiviral Prep)
Viral Prep#17446-LVPurposeReady-to-use Lentiviral Prep particles produced from pLenti CMV GFP Hygro (656-4) (#17446). In addition to the viral particles, you will also receive purified pLenti CMV GFP Hygro (656-4) plasmid DNA. Lentiviral particles carrying the GFP and hygromycin resistance.DepositorAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCL-Eco
Plasmid#12371DepositorInsertgag/pol/env
UseRetroviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
CRISPaint Gene Tagging Kit
Plasmid Kit#1000000086PurposeModular system for integrating large DNA fragments into defined genomic locations. Canonical NHEJ mechanism. For tagging of endogenous proteins with luciferase, fluorescent proteins, epitope tagsDepositorAvailable SinceSept. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-F-RAM-d2tTA-TRE-mKate2
Plasmid#140274PurposeF-RAM, the Fos-dependent reporterDepositorInsertmKate2
UseAAVPromoterTREAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry (AAV9)
Viral Prep#114472-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-mCherry (#114472). In addition to the viral particles, you will also receive purified pAAV-hSyn-mCherry plasmid DNA. Synapsin-driven mCherry control vector. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6d
Plasmid#207854PurposeMammalian expression of PE6d prime editorDepositorInsertPE6d
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrt(T128N, V223Y, D200C)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV9)
Viral Prep#50475-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-GFP
Plasmid#84040PurposeStaphylococcus aureus (SaCas9) conjugated with GFPDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-EGFPExpressionMammalianPromoterCMVAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-DIO-mNeonGreen-WPRE
Plasmid#223669PurposeCre-dependently expresses mNeonGreen in astorocytesDepositorInsertmNeonGreen
UseAAV and Cre/LoxPromoterGfaABC1DAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-EGFP
Plasmid#19319Purpose3rd gen lentiviral vector for EGFP fusion; PGK driven puromycinDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
GAL4BD-VP16/pDON207
Plasmid#201230PurposeGAL4-VP16 transcription factorDepositorInsertGAL4BD-VP16
ExpressionPlantAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV1)
Viral Prep#59171-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB_g5-HT3.0
Plasmid#208711PurposeExpresses the green 5-HT sensor GRAB_g5-HT3.0 in mammalian cellsDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT3.0
ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV8)
Viral Prep#44361-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceSept. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBL101-RUBY
Plasmid#199723PurposeExpresses betalain biosynthesis genes under CaMV 35S promoterDepositorInsert35S-RUBY
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (AAV1)
Viral Prep#100853-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (#100853). In addition to the viral particles, you will also receive purified pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven, Cre-dependent GECO1a calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
35S-VP16-GWY/pAM
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-GAL4BD/pAM
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pV238-vPE
Plasmid#225258PurposeMammalian expression of vPEDepositorInsertvPE
UseCRISPRExpressionMammalianMutationR221K K848A H982A N1317RPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6c
Plasmid#207853PurposeMammalian expression of PE6c prime editorDepositorInsertPE6c
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV R-CEPIA1er
Plasmid#58216PurposeRed fluorescent indicator for calcium signaling in the endoplasmic reticulumDepositorInsertR-CEPIA1er
TagsmycExpressionMammalianMutationR-GECO1 E300D M305L D329N F332I E336D N346K F361W…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS2
Plasmid#46954PurposeCloning plasmid for the generation of Knock-In in human cells using rAAV.DepositorTypeEmpty backboneUseAAVAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro
Pooled Library#73178PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF1106
Plasmid#143762PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mito).cpSFGFP.HaloTag
Plasmid#214925PurposeExpresses mitochondrially targeted non-responsive controlDepositorInsert(mito).cpSFGFP.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
c-myc-PT3EF1a
Plasmid#92046PurposeExpresses c-Myc in mammalian cellsDepositorAvailable SinceJuly 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH
Plasmid Kit#1000000163PurposeA collection of 20 plasmids encoding alpha, beta, or gamma subunits of the heterotrimeric G protein complex for detection of heterotrimer dissociation. GPCRDepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV1)
Viral Prep#59462-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-bacteria
Plasmid#44249PurposeaTc-inducible expression of a catalytically inactive bacterial Cas9 (S. pyogenes) for bacterial gene knockdownDepositorInsertdCas9 (bacteria)
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)PromoterpLtetO-1Available SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hIBA1a-GFP-miR124T
Plasmid#214147PurposeAAV vector to restrict GFP expression in microglia.DepositorHas ServiceAAV5InsertGFP
UseAAVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV9)
Viral Prep#59171-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only