171,694 results
-
Plasmid#124601PurposeExpresses protein A and Tn5 Transposase fusion protein in bacterial cellsDepositorInsertProtein A and hyperactive Tn5 transposase (Tnp) fusion protein
TagsProtein A and Tn5 transposase fusion protein with…ExpressionBacterialPromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eNpHR 3.0-EYFP (AAV5)
Viral Prep#26972-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-eNpHR 3.0-EYFP (#26972). In addition to the viral particles, you will also receive purified pAAV-hSyn-eNpHR 3.0-EYFP plasmid DNA. hSyn-driven eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEYFPAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_dCas9-5xGCN4_Hygro
Plasmid#235572PurposeDox-inducible expression of dCas9-GCN4 & genomic integrationDepositorInsertdCas9-5xGCN4
UseCRISPRMutationD10A; H840AAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mNeonGreen
Plasmid#99134PurposeAn AAV genome that ubiquitously expresses the fluorescent protein mNeonGreen from the CAG promoterDepositorInsertmNeonGreen
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKeima-LiveDrop
Plasmid#199695Purposelipophagy reporter system based on the Keima-fluorophoreDepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL1521 (pSPIN, pSC101* backbone)
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV MaCPNS1)
Viral Prep#37825-MaCPNS1PurposeReady-to-use AAV MaCPNS1 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV were produced with the MaCPNS1 serotype, which permits efficient transduction of the PNS in rodents and the CNS and PNS (including ENS) in marmosets and rhesus macaques. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgRNA
Plasmid#124844PurposeVector for Cre-dependent expression of SaCas9DepositorInsertSaCas9, gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsNLS and NLS-3xHAAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTP1183
Plasmid#104163PurposeBacterial expression plasmid of anti-rabbit IgG Fc nanobody TP897 (1x Cysteine)DepositorInsertAnti-rabbit IgG Fc specific nanobody TP897 (1xCysteine)
Tags14xHistidine tag and NEDD8 from Brachypodium dist…ExpressionBacterialAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
YAP/TAZ-TRE-mStrawberry reporter
Plasmid#158682PurposeThis plasmid is a YAP/TAZ pathway reporter. It has a YAP/TAZ-responsive synthetic promoter driving the expression of mStrawberry-pGK-BSDDepositorInsertmStrawberry
UseLentiviralExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hSK
Plasmid#27078PurposeIntegration-free (episomal) expression of human SOX2 and KLF4DepositorAvailable SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF0139
Plasmid#141533PurposeLentiviral vector for overexpressing the UBTF transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-eLACCO2.1-NGR
Plasmid#208023PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2.1
ExpressionMammalianAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-R-iLACCO1
Plasmid#208025PurposeBiosensor for intracellular L-lactateDepositorInsertR-iLACCO1
ExpressionMammalianAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA ADAR1 p150
Plasmid#237855PurposeLentiviral expression of ADAR1 p150DepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-deLACCO1-NGR
Plasmid#208024PurposeControl biosensor for extracellular L-lactateDepositorInsertdeLACCO1
ExpressionMammalianAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPSU10-30-50-100
Plasmid#173838PurposeCoexpresses 10, 30, 50 and 100 kD Penn State ladder proteinsDepositorInsertSTRHSTPAB
ExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-mScarlet
Plasmid#227274PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing mScarlet. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-mScarlet cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSU20-40-60-80
Plasmid#173839PurposeCoexpresses 20, 40, 60 and 80 kD Penn State ladder proteinsDepositorInsertSTRHSTPABPACCBPv3
ExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xFlag-eGFP-Flag-SETX
Plasmid#218838PurposeMammalian expression of GFP-tagged SETX construct for subcellular localization studies with GFP, or immunoprecipitation with Flag tag.DepositorAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mGreenLantern
Plasmid#161912PurposemGreenLantern fluorescent protein: cytosolic expression in mammalian cellsDepositorInsertmGreenLantern
ExpressionMammalianPromoterCMVAvailable SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA ADAR1 p110
Plasmid#237854PurposeLentiviral vector expressing ADAR1 p110DepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PE2max-BSD
Plasmid#191102PurposeLentiviral expression plasmid of PEmax prime editor with P2A-BSD markerDepositorInsertPEmax-P2A-BSD
UseCRISPR and LentiviralExpressionMammalianMutationChanged R221K, N394K, H840A from SpCas9PromoterEF-1aAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
TCR Rapid Assembly for Functional Testing (TCRAFT)
Pooled Library#1000000264DepositorAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
CDH5-AbR-GFP
Plasmid#122970PurposeLenti plasmid containing a CDH5 promoter driving GFP followed by T2A and an antibiotic resistance cassette (zeocin). Used for selection of endothelial cells.DepositorInsertsCDH5p
CopGFP
Zeocin
UseLentiviralExpressionMammalianMutationNAAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC1-HyPer-Red
Plasmid#48249PurposeGenetically encoded hydrogen peroxide indicator with red fluorescence.DepositorInsertHYPER-RED
ExpressionMammalianPromoterCMVAvailable SinceOct. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
VPS13C^mClover3
Plasmid#118760PurposeVPS13C internally tagged with mClover3 at residue 1914.DepositorAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT4/HB
Plasmid#108352PurposeOptimized Sleeping Beauty Transposon Vector with MCSDepositorTypeEmpty backboneUseTransposonAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai1
Plasmid#196048PurposeEncodes a G alpha subunit (GNAl1) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Tornado-F30-Pepper(TAR Variant-2)
Plasmid#129405Purposecircular Pepper RNADepositorInsertcircular F30-Pepper(TAR Variant-2)
ExpressionMammalianPromoterU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
SPLICS LY-MT Short P2A
Plasmid#213614PurposeDetect the short-range Lysosome-Mitochondria contactDepositorInsertSPLICS LY-MT Short P2A
ExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV2)
Viral Prep#59462-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceApril 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
dCAS9-VP64_GFP
Plasmid#61422PurposeExpresses dCAS9-VP64 activator with 2A GFPDepositorHas ServiceConcentrated Lentiviral PrepInsertdCAS9(D10A,H840A)-VP64_2A_GFP
UseCRISPR and LentiviralExpressionMammalianMutationD10A and H840A in Cas9PromoterEF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.PI.EGFP.WPRE.bGH (AAV9)
Viral Prep#105530-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CMV.PI.EGFP.WPRE.bGH (#105530). In addition to the viral particles, you will also receive purified pAAV.CMV.PI.EGFP.WPRE.bGH plasmid DNA. CMV-driven EGFP control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVTagsEGFPAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple (bidirectional) GasS
Plasmid#196055PurposeEncodes a G alpha subunit (GNAS2) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorInsertsUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lamp1-RFP
Plasmid#1817PurposeMammalian expression of Lamp1 fused to RFP. Used for localization to the lysosome.DepositorInsertlysosome associated membrane protein 1 (Lamp1 Rat)
TagsRFPExpressionMammalianMutationD50E (not important for function of plasmid)Available SinceSept. 26, 2005AvailabilityAcademic Institutions and Nonprofits only -
mCh-Climp63
Plasmid#136293Purposeexpression of Climp63DepositorAvailable SinceApril 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
SPLICS LY-MT Long P2A
Plasmid#213613PurposeDetect the long-range Lysosome-Mitochondria contactDepositorInsertSPLICS LY-MT Long P2A
ExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#100842-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 (#100842). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6s.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-ER alpha
Plasmid#28230PurposeMammalian expression of Estrogen Receptor alpha fused to EGFPDepositorAvailable SinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
S17-1λpir gyrAR462C
Bacterial Strain#237425PurposeThis engineered E. coli S17-1 λpir strain, featuring a mutation in the gyrA gene (462Arg→Cys), was designed to confer resistance to the CcdB toxin, allowing it to survive with a ccdB-carrying plasmid.DepositorBacterial ResistanceNoneAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDG02583
Plasmid#104129PurposeOptimized bacterial expression plasmid of bdNEDP1 protease (Frey and Goerlich, 2014)DepositorInsertNEDD8-specific protease 1 (NEDP1)
Tags14x Histidine tag, Maltose binding protein, and S…ExpressionBacterialAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mobius Assembly Vector Toolkit
Plasmid Kit#1000000134PurposeMobius Assembly is a Golden Gate-based cloning framework which renders both high cloning capacity and vector toolkit simplicity.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden GateAvailable SinceMarch 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pB-TAG-NICD
Plasmid#130934PurposePiggyBac vector for DOX-inducible human NICD-IRES-EGFP expression in mammalian cellsDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
InsRA-eGFP
Plasmid#79795PurposeInsulin receptor isoform A with a inter-domain eGFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.DepositorAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAJ075_hsCRBN
Plasmid#124214PurposeInsect cell expression vector for His6 tagged hsCRBNDepositorAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only