20,802 results
-
Plasmid#232428PurposeExpression plasmid for iPE-C prime editor RNPs with additional Csy4 protectionDepositorInsertiPE-C–P2A–Csy4
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA-human MYCN
Plasmid#74163PurposeMammalian expression of human MycNDepositorAvailable SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pylT-N346A/C348A
Plasmid#127411PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-canonical amino acids with mono-substituted phenylalanine derivatives and tyrosinyl ethersDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialMutationN346A-C348APromoteraraBADAvailable SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N EBNA3C
Plasmid#37958DepositorInsertEBNA3C (EBNA-3B/EBNA-3C H. Herpesvirus 4 (EBV))
UseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceAug. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
DRD2-Tango
Plasmid#66269PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
His6-MBP-uTEV3
Plasmid#135464PurposeBacterial expression of uTEV3 (full-length) proteaseDepositorInsertHis6-MBP-uTEV3
TagsMBP, His6ExpressionBacterialMutationS219V mutation (improves stability) , I138T/S153N…PromoterT5Available SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-Fibrillarin
Plasmid#26673DepositorAvailable SinceNov. 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
BFP-Rab5
Plasmid#49147Purposemammalian expression of TagBFP-Rab5 fusionDepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBR322-PVCpnf18-21
Plasmid#198273PurposeContains only regulatory genes; for generating empty PVCsDepositorInsertPVCpnf18-21
ExpressionBacterialAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1(wt)
Plasmid#13719DepositorAvailable SinceMarch 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV8 trial size)
Viral Prep#50465-AAV8.TPurposeReady-to-use AAV8 trial size particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
AbVec1.1-IGLC2-XhoI
Plasmid#99575PurposeExpression of immunoglobulin light chains in mammalian cells, human lambda 2 constant regionDepositorTypeEmpty backboneExpressionMammalianPromoterhCMV IE1 gene promoterAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-GFP
Plasmid#159654PurposeEmpty backbone for cloning gRNA sequences for DNA targeting. Contains an T2A linked H2B GFP nuclear reporter.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep
Plasmid#92099PurposeDoyon lab Tandem-Affinity Purification Following Nuclease-Driven Gene Addition to the AAVS1 Genomic Safe Harbor Locus. Transgene expression is controlled by an Auto-Regulated Tet-On 3G System.DepositorTypeEmpty backboneUseCRISPR and TALEN; ZfnExpressionMammalianPromoterTet-On 3G BidirectionalAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG mito-RCaMP1h
Plasmid#105013Purposemitochondrial calcium sensorDepositorInsertRCaMP1h
ExpressionMammalianPromoterpCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-eYFP (AAV PHP.eB)
Viral Prep#117382-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn1-eYFP (#117382). In addition to the viral particles, you will also receive purified pAAV-hSyn1-eYFP plasmid DNA. hSyn-driven eYFP expression. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagseYFPAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Integrin-Beta1-N-18
Plasmid#55064PurposeLocalization: Integrin/Focal Adhesions, Excitation: 587, Emission: 610DepositorAvailable SinceAug. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-HA-rM3D(Gs)-IRES-mCitrine
Plasmid#50468PurposeGs-coupled rM3D-IRES-mCitrine under the control of CaMKIIa promoterDepositorInsertrM3D-IRES-mCitrine
UseAAVTagsHAMutationSee supplemental documents for DREADD mutationsPromoterCaMKIIaAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tubulin-6
Plasmid#56450PurposeLocalization: Microtubules, Excitation: 488, Emission: 507DepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBPp65ADZpUw
Plasmid#26234DepositorInsertp65AD-Zip (RELA Human)
ExpressionInsectAvailable SinceOct. 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(F74G)
Plasmid#140730PurposeOsTIR1(F74G)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(F74G)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cFos-tTA-pA
Plasmid#66794PurposeExpresses TetActivator protein under the control of the c-fos promoter for use in TetTagingDepositorInsertcfos promoter linked to the tet activator gene
UseAAVTagsnoExpressionMammalianAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-flex-taCasp3-TEVp
Plasmid#45580DepositorHas ServiceAAV1, AAV5, and AAV8InsertsUseAAV; Adeno associated viral vectorMutationLinker replaced with a TEV protease cleavage sitePromoterEF1aAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV.TBG.PI.Cre.rBG
Plasmid#107787PurposeAAV vector expressing Cre from TBG promoterDepositorHas ServiceAAV8InsertCre
UseAAVExpressionMammalianPromoterTBGAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PIK3CA-E542K
Plasmid#116479PurposeLentiviral expression of PIK3CA E542KDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-RLuc8
Plasmid#87121PurposeMammalian expression vector expressing mutant version of the reporter gene-Renilla Luciferase (Rluc8), which is more stable in mouse serum and has more light output.DepositorInsertRenilla Luciferase
UseLuciferaseExpressionMammalianMutationA55T, C124A, S130A, K136R, A143M, M185V, M253L, a…PromoterCMVAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9
Plasmid#49330PurposeExpresses sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertsCas9
dU6-sgRNA
UseCRISPRTags3xFLAG and NLSExpressionInsectMutationHuman codon optimisedPromoterActin-5c and Drosophila U6Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
ERM-APEX2
Plasmid#79055PurposeSoybean APEX2 anchored to cytosolic face of ER membrane with N-terminal targeting sequence of residues 1-27 of ER-resident P450 oxidase 2C1.DepositorInsertAPEX2 anchored to the cytosolic face of the ER membrane
UseLentiviralTagsResidues 1-27 of P450 oxidase 2C1 and V5ExpressionBacterial and MammalianPromoterCMV immearly promotorAvailable SinceAug. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS2-Spike
Plasmid#145032PurposeExpress SARS-CoV-2 spike protein with C9 tag at C-terminal in mammalian cellsDepositorAvailable SinceApril 15, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
tdTomato-N1
Plasmid#54642PurposeLocalization: N1 Cloning Vector, Excitation: 554, Emission: 581DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagstdTomatoExpressionMammalianPromoterCMVAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
BoxB in pcDNA3
Plasmid#29727DepositorInsert5BoxB
ExpressionMammalianAvailable SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-ArchT-GFP (PV2527) (AAV5)
Viral Prep#99039-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CamKII-ArchT-GFP (PV2527) (#99039). In addition to the viral particles, you will also receive purified pAAV-CamKII-ArchT-GFP (PV2527) plasmid DNA. CaMKII-driven ArchT-GFP expression for optogenetic inhibition.DepositorPromoterCaMKIITagsGFPAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP12
Plasmid#67514PurposeFKBP12 onlyDepositorAvailable SinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
PGK-AAVS1ZFNR
Plasmid#60915Purposeencodes zinc finger nuclease specific to AAVS1 locus (right)DepositorInsertAAVS1-ZFNR
PromoterPGKAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human SAM library in lenti sgRNA(MS2)_puro backbone
Pooled Library#1000000074PurposeGenome-wide CRISPR gRNA pooled library for activation of mouse genesDepositorAvailable SinceMarch 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
C1(1-29)-TurboID-V5_pCDNA3
Plasmid#107173Purposeexpresses V5-tagged TurboID on the mammalian ER membraneDepositorInsertTurboID (BirA mutant)
ExpressionMammalianMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Available SinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFlag IFIT3
Plasmid#53553Purposemammalian expression of IFIT3DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (AAV PHP.eB)
Viral Prep#104491-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-FLEX-jGCaMP7s-WPRE (#104491). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven, Cre-dependent, GCaMP7s calcium sensor. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2) cloning backbone
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
ER-mNeonGreen
Plasmid#137804PurposeVisualization of the Endoplasmic ReticulumDepositorInsertKDEL
ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-beta-3
Plasmid#27289DepositorAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCFD5_w
Plasmid#112645PurposeUbiquitous expression of one or multiple sgRNAs in Drosophila. Selection marker: Mini-white.DepositorInsertU6:3-tRNA-sgRNA expression cassette
ExpressionInsectAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
hsgk1
Plasmid#83432Purposefull length human sgk1 with Flag tagDepositorAvailable SinceNov. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-JMJD3
Plasmid#24167PurposeMammalian expression of human JMJD3 with HA tagDepositorAvailable SinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
ZJOM65
Plasmid#133654PurposeIntegration of VPH1-mCherry as an additional copy in genome, use auxotrophic marker TRP1(Kluyveromyces lactis). Marker for yeast vacuole.DepositorAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-mhYFP
Plasmid#186533PurposeMonomeric hyperfolder YFP fluorescent protein: cytosolic expression in mammalian cellsDepositorInsertMonomeric hyperfolder YFP
ExpressionMammalianMutationhfYFP-S147P/L195M/V206KPromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry (AAV1)
Viral Prep#135634-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-S5E2-ChR2-mCherry (#135634). In addition to the viral particles, you will also receive purified pAAV-S5E2-ChR2-mCherry plasmid DNA. Expression of ChR2-mCherry under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only