20,807 results
-
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBluescript-PB
Plasmid#133885PurposepiggyBac ITR's in high copy number pBluescript backbone plasmidDepositorTypeEmpty backboneUsePiggybacAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pY001 (pFnCpf1_full)
Plasmid#69973PurposeExpresses FnCpf1 locus including Cas genes and spacers 1-4 of CRISPR array.DepositorInsertFnCpf1 locus
UseCRISPRExpressionBacterialAvailable SinceOct. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
paGFP
Plasmid#18697DepositorInsertphotoactivatable GFP
ExpressionMammalianMutationA206K mutationPromoterCMVAvailable SinceJuly 2, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBT44c
Plasmid#122600PurposeBE PACE selection, express C-intein-Cas9-ugi fusionDepositorInsertintein-dCas9-ugi fusion
UseSynthetic BiologyAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam APC 1-1941
Plasmid#16510DepositorAvailable SinceApril 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
Flag-FOXK1
Plasmid#153132PurposeExpression of Flag tagged human FOXK1 in mammalian cellsDepositorAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-tdTomato
Plasmid#97079PurposeRetroviral plasmid containing tdTomato for labeling of cellsDepositorInserttdTomato
ExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-6xHIS.Mm.RPE65-eGFP
Plasmid#41019DepositorAvailable SinceDec. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Rootletin (Nigg pFL2(CW499))
Plasmid#41166DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET15bHis6Tnp
Plasmid#79807PurposeTransform BL21 Gold(DE3) to induce the expression of HisTnp hyperactive mutationsDepositorInsertHis6Tnp
TagsHisExpressionBacterialAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-ReaChR-citrine
Plasmid#50956PurposeReaChR-citrine in lentival transfer vector under human synapsin promoterDepositorInsertReaChR-citrine
UseLentiviralTagscitrinePromoterhuman synapsin promoterAvailable SinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Rasgrf2-2A-dCre targeting vector
Plasmid#61573PurposeTarget a DHFR-destabilized Cre recombinase gene to the stop codon of the mouse Rasgrf2 geneDepositorInsertRasgrf2-2A-dCre (Rasgrf2 Mouse, P1 bacteriophage)
UseCre/Lox and Mouse TargetingAvailable SinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIreSneo-FLAG/HA Ago3
Plasmid#10823DepositorAvailable SinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pGateway 3XFlag Prickle1 flag tagged
Plasmid#24644DepositorAvailable SinceApril 30, 2010AvailabilityIndustry, Academic Institutions, and Nonprofits -
p4458 FLAG-hPLIC-1
Plasmid#8663DepositorAvailable SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
C1-MPAct-mCitrine
Plasmid#155220PurposeMonitor changes in the density of membrane-proximal F-actin (MPA)DepositorInsertF-tractin (aa 9-52 of rat ITPKA) fused to mCitrine C-term tagged with the CaaX sequence derived from Kras4b
TagsmCitrineExpressionMammalianAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP-EF1a-mCherry
Plasmid#115782PurposeSox10-MCS5-GFP and a constitutive EF1α-mCherry reporter plasmid. Construct generates constitutive red fluorescence and basal promoter cfos conjugated SOXMCS5 enhancer driven GFP expression in a cell.DepositorInsertsmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
EF1alpha promoter driven constitutive mCherry
UseLentiviralTagsEF1α promoter fused to mCherry and cfos promoter …PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
GLuc-PM
Plasmid#164783PurposeGaussia luciferase (GLucM23) targeted to the extracellular surface of the cell membrane for bioluminescence resonance energy transfer (BRET)-based measurement of ligand binding to unmodified receptorsDepositorInsertGaussia luciferase fused with the transmembrane domain of the platelet-derived growth factor receptor beta (PDGFRB Gaussia princeps, Human)
TagsGLucExpressionMammalianPromoterCMVAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
human p53-(82-393)
Plasmid#24867DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-dV-IgG1/λ
Plasmid#52214PurposeHuman immunoglobulin gamma 1 antibody expression vector (lambda light chain) without variable regions. Enables Colony-PCR screening of false-positive (PCR vector template) coloniesDepositorInsertsHuman immunoglobulin gamma 1 constant region
Human immunoglobulin lambda constant region
ExpressionMammalianMutationDeleted Variable regionPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pC001 - huLshC2C2-MBP for bacterial expression
Plasmid#79150PurposeExpresses human codon-optimized LshC2c2 for purification in E. coliDepositorInsertC2c2
ExpressionBacterialPromoterT7Available SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1-wt
Plasmid#12980DepositorAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBLADE(FP6**)-mCherry
Plasmid#168049PurposeExpresses the synthetic gene BLADE FP6 under the constitutive J23101** promoter. mCherry expression is controlled by the PBAD promoter.DepositorInsertsBlue light-inducible AraC dimers in Escherichia coli
mCherry
ExpressionBacterialPromoterJ23101** and PBADAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
iOn-CAG∞RFP
Plasmid#154014PurposeVector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein mRFP1 from a CAG promoter upon action of the piggyBac transposaseDepositorInsertmRFP1
ExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP spGFP-ERGIC53
Plasmid#38270DepositorInsertERGIC-53 (LMAN1 Human)
UseRetroviralTagsEGFP with Calreticulin signal peptide at N-termin…ExpressionMammalianMutationdeleted signal peptide (1-30 amino acids)Available SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-PIS
Plasmid#119078PurposeVisualize localization of ER enzyme Phosphatidylinositol Synthase (PIS)DepositorAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSII416
Plasmid#35456DepositorTypeEmpty backboneUseYeast centromere vectorPromoterNoneAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CSF1R
Plasmid#23928DepositorInsertCSF1R (CSF1R Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
AbVec2.1-mIglc2
Plasmid#127156PurposeExpression of immunoglobulin light chains in mammalian cells, mouse (C57BL/6), lambda 2 constant regionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS1096 Dual-sgRNA.Design 1
Plasmid#159538PurposeDelivery of dual sgRNA cassettes and Nme2Cas9 in a single AAV vectorDepositorInsertNme2Cas9 nuclease with two guide RNA cassettes with promoters
UseAAV, CRISPR, and Mouse TargetingTagsNLSExpressionMammalianPromoterU1aAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDS24
Plasmid#58952PurposeEncodes synthetic mitochondrial gene ARG8m in place of COX3 coding sequence. Flanked by mtDNA sequences allowing integration into rho+ mtDNA after transformation.DepositorInsertMitochondrially coded Arg8 protein
MutationCoding sequence synthetic in S. cerevisiae mitoch…Promotern/aAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRV.GFP FOXP3
Plasmid#13250DepositorAvailable SinceOct. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
RelB cFlag pcDNA3
Plasmid#20017DepositorAvailable SinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMGS46 (ARF16-PB1-HA-P2A-OsTIR1)
Plasmid#126580PurposeA repair construct to express ARF16-PB1-HA and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsHAExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for calcium ion
Plasmid#60887PurposeFPX biosensorDepositorInsertsingle polypeptide FPX biosensor for calcium ion
TagsHindIII siteExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tom20-CIB-GFP
Plasmid#117242PurposeLight activated recruitment to OMM in mammalian cells with Cry2/CIB optogenetic switchDepositorInsertCIBN
TagsGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 Cyclin E1
Plasmid#109348Purposevirus packaged, doxycyline inducible expression of Cyclin E1DepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)
Plasmid#108292PurposepX459 V2.0 (Plasmid #62988) with the K848A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Snail_pGL2
Plasmid#31694DepositorAvailable SinceSept. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EOS-S(4+)-EiP
Plasmid#21314PurposeLentiviral EOS reporter with Sox2 enhancer (x4), expresses EGFP and Puro resistanceDepositorInsertEnhanced Green Fluorescence Protein, Puromycin resistance gene
UseLentiviralExpressionMammalianPromoterEOS-S(4+) promoter regionAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
dg265_pENTR_CoChRCel
Plasmid#66103PurposeEntry clone containing CoChR coding sequence (without stop codon), codon optimized for C. elegans, with synthetic introns, flanked by attL1 and attL2DepositorInsertCoChR
UseGatewayAvailable SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
PBAD-his6-prkA-pACYC184
Plasmid#41041DepositorInsertprkA
Tags6xHis and T7 epitope tagExpressionBacterialPromoterPBADAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBAD-GINKO1
Plasmid#113111PurposeBacterial expression of genetically encoded green fluorescent potassium ion indicator GINKO1DepositorInsertGINKO1
Tags6-His Tag, T7 tag (gene 10 leader), and Xpress™ t…ExpressionBacterialPromoteraraBADAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sabatini/Lander Lab Activity-Optimized Genome-wide Human sgRNA Library in pLenti-sgRNA
Pooled Library#1000000095PurposeCRISPR gRNA knockout pooled library for targeting the human genomeDepositorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2
Plasmid#22424DepositorTypeEmpty backboneUseDestination vectorAvailable SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-BAX
Plasmid#16587DepositorAvailable SinceMarch 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET28CLY1
Plasmid#21760DepositorInsertECFP -EYFP linked by flexible one SGGSGG repeats
TagsHisExpressionBacterialAvailable SinceDec. 1, 2009AvailabilityAcademic Institutions and Nonprofits only