23,809 results
-
Plasmid#31786DepositorInsertMet (MET Human)
UseEntry vectorAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLCKO2
Plasmid#125518PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BsmBI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTCF156 HLA-A*02:01
Plasmid#180456PurposeE. coli expression of soluble MHC proteinDepositorInsertHLA-A*02:01
TagsBSP41ExpressionBacterialMutationReplacement of transmembrane domain with enzymati…Available SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY100-RetroEFS-HER2-28BBz-WPRE
Plasmid#192201PurposeRetro-HER2CARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom (AAV1)
Viral Prep#135630-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-S5E2-dTom-nlsdTom (#135630). In addition to the viral particles, you will also receive purified pAAV-S5E2-dTom-nlsdTom plasmid DNA. Bicistronic expression of dTomato and nuclear-targeted dTomato under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorTagsdTomatoAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-Cas9-His
Plasmid#47327PurposeFor in vitro expression and purification of Cas9 proteinDepositorInsertCas9
UseCRISPRTagsHisExpressionBacterialAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-TMPRSS2-puro
Plasmid#158457PurposeConstitutive lentiviral expression of human TMPRSS2.DepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_tBFP_PGK_mCitrine
Plasmid#188386PurposeLentiviral vector - tBFP reporter for Gal4-based SNIPRs with a constitutive mCitrine;DepositorInsertGal4UAS_tBFP_PGK_mCitrine
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTrEno
Plasmid#115474PurposeEno-promoter driven expression vector for protein production in Trichoderma reeseiDepositorInsertCel7A
UseUnspecifiedMutationIntrons have been removedPromoterTrichoderma reesei Enolase (Eno) promoterAvailable SinceOct. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
NC16 pCDNA3.1 FLAG NRF2
Plasmid#36971DepositorAvailable SinceJuly 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSBbi G418 Hu CD19
Plasmid#183247PurposeExpression of human CD19 antigen in a Sleeping Beauty transposon vectorDepositorInsertCD19 (CD19 Human)
ExpressionMammalianAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 F-tractin-EGFP
Plasmid#58473PurposeExpresses a cytoplasmic actin filament reporter, the neuronal inositol 1,4,5-triphosphate 3-kinase A actin-binding domain known as F-tractin, on a CMV promoterDepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Dual-sgRNA_hU6-mU6
Plasmid#154194PurposeLentiviral expression plasmid for two sgRNAs from a hU6 and a mU6 promoter. The cloning site design allows a one-step cloning strategy of both sgRNAs. Expresses a Thy1.1 marker.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDsRed-attP
Plasmid#51019PurposeVector for generating dsDNA donors for homology-directed repair to replace genes or other genomic sequence with an attP docking site. Contains the visible marker 3xP3-DsRed. As known as pHD-DsRed-attPDepositorInsertsattP
LoxP-3xP3-DsRed-LoxP
UseHigh copy, amp resistancePromoter3xP3 and NoneAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-Luc2-P2A-copGFP
Plasmid#72485PurposeExpress Luc2 and copGFPDepositorInsertLuc2-P2A-copGFP
UseLentiviralExpressionMammalianPromoterEF-1Available SinceJan. 11, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEX-PK-hLC3
Plasmid#61458PurposeExpress pHluorin-mKate2-hLC3 (PK-hLC3) in mammalian cells for monitoring autophagyDepositorAvailable SinceFeb. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xFLAG-V5-ccdB
Plasmid#87064PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneTags3xFLAG-V5ExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FU- dio PSD95-mCherry- W
Plasmid#73919PurposeExpresses PSD-95 tagged with mCherry. Expression is Cre dependent. Plasmid can also be used to make lentivirus.DepositorInsertPSD-95-mCherry
UseLentiviralTagsmCherry and mycExpressionMammalianPromoterUbi-CAvailable SinceApril 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet3-alphaTubulin_C1
Plasmid#189768PurposeConstruct for labelling microtubules in mammalian cells with mScarlet3-alphatubulinDepositorInsertmScarlet3-alphaTubulin
ExpressionMammalianPromoterCMVAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNX32-Dest
Plasmid#105083PurposeYeast mating-based Split Ubiquitin Assay, prey vector for Gateway cloningDepositorTypeEmpty backboneTagsNubGExpressionYeastAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJBEI-6409
Plasmid#47048PurposeBglBrick plasmid (=pBbA5c-MTSAe-T1f-MBI(f)-T1002i-Ptrc-trGPPS(co)-LS) coding for MEV pathway enzymes to produce limonene from glucose in E. coliDepositorInsertCodon-optimized sequences for MEV pathway expression in E. coli to produce limonene
UseSynthetic Biology; BglbrickExpressionBacterialPromoterPlacUV5Available SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
N1-Tq-Ca-FLITS
Plasmid#191454PurposeGenetically encoded calcium sensor (GECI) Tq-Ca-FLITS that reports with lifetime and intensity changesDepositorInsertTq-Ca-FLITS
ExpressionMammalianAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/CIP2A(1-905) WT V5 His
Plasmid#119287PurposeCIP2A WT V5 overexpressionDepositorAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-syn-GCaMP6m-XC
Plasmid#118975PurposeImproved genetic encoded calcium sensor based on GCaMP6mDepositorInsertGCaMP6m-XC
UseAAVAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SynB
Plasmid#174861PurposeExpresses mouse syncytin B in mammalian cellsDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 (AAV1)
Viral Prep#100846-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 (#100846). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.NES-jRCaMP1a.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent jRCaMP1a calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRS306-URA3-PHIS3-AqLumSynth –Sapphire
Plasmid#116931PurposeYeast integrative vector for the exression of the 20nm GEM under the HIS3 promoterDepositorInsertlumazine synthase
TagsSapphireExpressionYeastPromoterHIS3Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.cTNT.PI.eGFP.WPRE.rBG
Plasmid#105543PurposeAAV expression of EGFP from cTNT promoterDepositorHas ServiceAAV9InsertcTNT-PI-EGFP
UseAAVExpressionMammalianPromotercTNTAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTEF2
Plasmid#43971DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterial and YeastPromoterTEFAvailable SinceApril 9, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
ankG-mCherry
Plasmid#42566DepositorAvailable SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-ccdB-3xFLAG-V5
Plasmid#87071PurposeLentiviral Gateway-compatible expression vector backbone with a C-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneUseLentiviralTags3xFLAG-V5ExpressionMammalianAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIE1
Plasmid#136355PurposeSelection by Inducible EffectorsDepositorInsertsType VI effector bfe1
Type VI effector bte1
BT_4676
tetR
UseUnspecifiedMutationATG removed to add signal sequence before genePromoterP1TDP-GHO23Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (AAV Retrograde)
Viral Prep#100854-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (#100854). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven GECO1a calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pE-FLP
Plasmid#45978PurposeExpresses yeast Flp driven by the constitutive promoter pE from phage P2DepositorInsertflp
UseSynthetic BiologyExpressionBacterialMutationflp driven by the constitutive promoter pE from p…PromoterpE (from phage P2)Available SinceJuly 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pmScarlet_Giantin_C1
Plasmid#85048PurposeIn vivo visualization of the Golgi apparatus (can be used for colocalization studies)DepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV1)
Viral Prep#104492-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
Pink Flamindo
Plasmid#102356Purposebiosensor for cAMP in mammalian cellsDepositorInsertPink Flamindo
ExpressionMammalianPromoterCMVAvailable SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX TRE 3G BFP
Plasmid#128070PurposeLentiviral expression of Tet inducible TagBFPDepositorInsertTagBFP
UseLentiviralExpressionMammalianMutationnoAvailable SinceAug. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-FRT/T0-Flag-PALB2
Plasmid#71114Purposemammalian expession of FLAG-PALB2DepositorAvailable SinceDec. 9, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTS118 His14-Avi-28xGS-anti ALFA tag nanobody
Plasmid#199371PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-ALFA nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
mRFP1-N1
Plasmid#54635PurposeLocalization: N1 Cloning Vector, Excitation: 584, Emission: 607DepositorTypeEmpty backboneTagsmRFP1ExpressionMammalianAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti6/V5-p53_wt p53
Plasmid#22945Purpose3rd generation lentiviral vector encoding human p53 with a C-terminal V5 tagDepositorAvailable SinceJan. 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLSC-5
Plasmid#62889PurposeLenti vector for expression of inducible split Cas9DepositorInsertsSpCas9(574-1368)
SpCas9(2-573)
UseCRISPR and LentiviralTagsFFBP12, FRB, NES PTK2, NLS SV40, and P2AExpressionMammalianMutation*see comment belowPromoterEFSAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJOE7706.1
Plasmid#135075PurposeA shuttle vector for heterologous HA production with Corynebacterium glutamicumDepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Clathrin-15
Plasmid#54040PurposeLocalization: Clathrin Vesicles, Excitation: 487, Emission: 509DepositorAvailable SinceJuly 2, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJ4M_hnRNPA2_FL_WT
Plasmid#139109PurposeExpress FL hnRNPA2 with a C-terminal MBP tagDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC13N-dCas9-BFP-KRAB
Plasmid#127968Purposeconstitutive expression of dCas9-BFP-KRAB from the CLYBL locus (Ward lab)DepositorInsertCLYBL-CAG-dCas9-NLS-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV/L7-6-GFP-WPRE
Plasmid#126462PurposeAn AAV vector that expresses GFP under the control of the L7-6 promoter. The L7-6 promoter is the short size (0.8-kb) and has highly specificity to Purkinje cells.DepositorInsertL7-6, Purkinje cell specific promoter
UseAAVExpressionMammalianAvailable SinceMay 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW57-RFP-P2A-MCS (Neo)
Plasmid#89182PurposeAll-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo RFP using the P2A self-cleaving peptide.DepositorTypeEmpty backboneUseLentiviral; Doxycycline inducible; p2a self cleav…ExpressionMammalianPromoterTREAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only