20,802 results
-
Plasmid#53186PurposeExpresses the S. pyogenes sgRNA from the H1 promoterDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhuman H1Available SinceJune 25, 2014AvailabilityAcademic Institutions and Nonprofits only
-
FLAG-TRAF6-wt
Plasmid#21624DepositorAvailable SinceJuly 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-APOBEC1-YTH
Plasmid#178949PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTH in mammalian cellsDepositorInsertAPOBEC1-YTH-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Mm.cargo(Cre)
Plasmid#174862PurposeExpresses mouse Peg10 cargoRNA encoding Cre recombinaseDepositorInsertCre flanked by MmPeg10 UTRs
ExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-puro-ARID1A
Plasmid#39478PurposeTetracycline-inducible lentiviral expression of human ARID1A; 3rd generation lentiviral vectorDepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1-SIO-stGtACR1-FusionRed (AAV5)
Viral Prep#105678-AAV5PurposeReady-to-use AAV5 particles produced from pAAV_hSyn1-SIO-stGtACR1-FusionRed (#105678). In addition to the viral particles, you will also receive purified pAAV_hSyn1-SIO-stGtACR1-FusionRed plasmid DNA. Synapsin-driven, Cre-dependent, soma-targeted anion-conducting channelrhodopsin fused to FusionRed for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsFusionRed (Cre-dependent)Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Hexim2 (P#1897)
Plasmid#14663DepositorAvailable SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pQE80L-SpyCatcher-ELP-GFP
Plasmid#69835PurposeBacterial expression plasmid containing SpyCatcher-ELP-GFP fusion. SpyCatcher forms a covalent bond with SpyTag and can be used to label plasma membrane localized SpyTag-C1C2 in live cells.DepositorInsertSpyCatcher-ELP-GFP
Tags6x His Tag, GFP, and TEV TagExpressionBacterialPromoterT5 promoter/lac operator elementAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGRG25
Plasmid#16665DepositorInsertmTn7::MCS
ExpressionBacterialAvailable SinceJan. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
AAV2-miniSOG-VAMP2-T2A-mCherry
Plasmid#50970PurposeAAV2 transfer vector containing the InSynC (miniSOG-VAMP2-T2A-mCherry) constructDepositorInsertminiSOG-VAMP2-T2A-mCherry (Vamp2 Mouse, Arabdopsis thaliana)
UseAAVTagsT2A-mCherry and miniSOGPromoterhuman synapsin promoterAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1delltaH5
Plasmid#71714PurposeMembrane scaffold protein (MSP), helix 5 deletionDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJG100
Plasmid#138966PurposePeft-3::wrmScarlet1-10::unc-54 3’UTR. Expresses wrmScarlet1-10 in somatic tissues of C. elegansDepositorInsertwrmScarlet1-10
ExpressionWormAvailable SinceJuly 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.LSL.tdTomato
Plasmid#100048PurposeAAV mediated Cre-dependent expression of tdtomato (Lox-Stop-Lox)DepositorInserttdtomato
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-nbOcIgG-Tn5
Plasmid#184285PurposeAnti-rabbit IgG Fc specific nanobody-Tn5 for NTT-seq (multiplexed CUT&Tag)DepositorInsertnbOcIgG-Tn5
Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMetYC-Dest
Plasmid#105081PurposeYeast mating-based Split Ubiquitin Assay, bait vector for Gateway cloning. Cub-PLV does not contain a start codon.DepositorTypeEmpty backboneTagsCub-PLVExpressionYeastAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNSEN-d2
Plasmid#59763PurposeExpresses nuclear EGFP and Tomato in mammalian cellsDepositorInsertsd2-EGFP
Tomato
Tags3X NLS and PESTExpressionMammalianPromoterCMV promoter and SV40 promoterAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-EGFP
Plasmid#50469PurposeEGFP under the control of CaMKIIa promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEGFP
UseAAVTagsN/APromoterCaMKIIaAvailable SinceMarch 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
Tn7 integration plasmid
Plasmid#154134PurposeSuicidal integration plasmid with the Tn7 arms, streptomycin and kanamycin resistance genes and the restriction site to clone the barcode-carrying cassette.DepositorInsertsleft and right end of Tn7 arm
Spectinomycin resistant gene
ExpressionBacterialPromoterSpectinomycin resistance gene promoter and noAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CXCL12-sfGFP
Plasmid#98961PurposeMammalian expression plasmid for superfolder GFP-fused human chemokine CXCL12DepositorInsertCXCL12 (CXCL12 Human)
TagsSuperfolder GFPExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p6351 MSCV-CMV-CMV-Flag-HA-NSD3
Plasmid#31357DepositorAvailable SinceOct. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE27
Plasmid#90369PurposeType II Interferon - STAT1/STAT1 gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterSTAT1Available SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6b-V106W
Plasmid#215825PurposeExpress CBE6b V106W (with SpCas9) in mammalian cellsDepositorInsertCBE6b V106W-SpCas9-2xUGI (cas9 )
UseIn vitro transcription templateAvailable SinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV Retrograde)
Viral Prep#50475-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. CNO-induced neuronal silencing. Synapsin-driven with mCherry reporter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP×2-N1
Plasmid#86775PurposeA mammalian expression vector with double EGFP at C-terminus.DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKSE401
Plasmid#62202PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPSU10-30-50-100
Plasmid#173838PurposeCoexpresses 10, 30, 50 and 100 kD Penn State ladder proteinsDepositorInsertSTRHSTPAB
ExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgKEAP1-2
Plasmid#186459Purposeknock out KEAP1 in mammalian cellsDepositorInsertKeap1 (Kelch-like ECH-associated protein 1) (KEAP1 Human)
UseCRISPR and LentiviralAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-D2cpV
Plasmid#37471DepositorInsertD2cpv second generation cameleon (calcium sensor)
ExpressionMammalianPromoterCMVAvailable SinceOct. 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dU6:3gRNA
Plasmid#49410Purposeexpression of gRNA under control of the Drosophila U6:3 promoterDepositorInsertdU6-3:gRNA
UseCRISPRExpressionInsectPromoterdU6-3Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAKTaq
Plasmid#25712PurposeBacterial expression of Taq polymeraseDepositorInsertTaq polymerase
ExpressionBacterialAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBRIT HA/FLAG
Plasmid#17519DepositorTypeEmpty backboneUseCre/Lox and RetroviralTagsFLAG and HAExpressionMammalianAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
EGFR-mEGFP
Plasmid#203774PurposeNumber and brightness analysis of EGFR oligomerizationDepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synP-FLEX-splitTVA-EGFP-B19G (AAV1)
Viral Prep#52473-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-synP-FLEX-splitTVA-EGFP-B19G (#52473). In addition to the viral particles, you will also receive purified pAAV-synP-FLEX-splitTVA-EGFP-B19G plasmid DNA. Helper virus for monosynaptic tracing with rabies virus. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
mScarlet-Rab7
Plasmid#169068PurposeExpress human Rab7a in mammalian cellsDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
BJ5183 cells
Bacterial Strain#16398DepositorBacterial ResistanceStreptomycinSpeciesEscherichia coliAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
Cre Stoplight 2.4
Plasmid#37402PurposeCre activity reporter plasmid; Zsgreen is expressed in cells without Cre, mCherry is expressed with CreDepositorInsertCre Stoplight 2.4
TagsZsGreen1 and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV-ReaChR-citrine
Plasmid#50954PurposeReaChR-citrine in AAV2 vector under human synapsin promoterDepositorInsertReaChR-citrine
UseAAVTagscitrinePromotertruncated human Synapsin promoterAvailable SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-OSKM
Plasmid#20321PurposeLentiviral plasmid for tet-inducible expression of mouse Oct4, Sox2, Klf4 and Myc for iPS cell generationDepositorAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSF1389
Plasmid#104962PurposeBacterial expression plasmid of bdSENP1 proteaseDepositorInsertSENP1
TagsHis14 tag and Tev protease cleavage siteExpressionBacterialPromoterlacUV5Available SinceJan. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-DsRed FP (pMIDsRed II)
Plasmid#52110Purposea bicistronic IRES-DsRed containing retroviral vector, MCS is expanded from pMSCV-IRES-GFPDepositorTypeEmpty backboneUseRetroviralTagsIRES-DsRedExpressionMammalianAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR-c-Met
Plasmid#31786DepositorInsertMet (MET Human)
UseEntry vectorAvailable SinceOct. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLCKO2
Plasmid#125518PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BsmBI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTCF156 HLA-A*02:01
Plasmid#180456PurposeE. coli expression of soluble MHC proteinDepositorInsertHLA-A*02:01
TagsBSP41ExpressionBacterialMutationReplacement of transmembrane domain with enzymati…Available SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY100-RetroEFS-HER2-28BBz-WPRE
Plasmid#192201PurposeRetro-HER2CARDepositorAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom (AAV1)
Viral Prep#135630-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-S5E2-dTom-nlsdTom (#135630). In addition to the viral particles, you will also receive purified pAAV-S5E2-dTom-nlsdTom plasmid DNA. Bicistronic expression of dTomato and nuclear-targeted dTomato under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorTagsdTomatoAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-Cas9-His
Plasmid#47327PurposeFor in vitro expression and purification of Cas9 proteinDepositorInsertCas9
UseCRISPRTagsHisExpressionBacterialAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLEX307-TMPRSS2-puro
Plasmid#158457PurposeConstitutive lentiviral expression of human TMPRSS2.DepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only